>Feature sequence001 <1 753 gene locus_tag LOCUS_00010 <1 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_085938409.1:IS256 family transposase 892 1083 gene locus_tag LOCUS_00020 892 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1225 1150 gene locus_tag LOCUS_t00010 1225 1150 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1432 2088 gene locus_tag LOCUS_00030 gene trmB 1432 2088 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939002.1 protein_id gnl|my_center|LOCUS_00030 3060 2113 gene locus_tag LOCUS_00040 3060 2113 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892121.1 protein_id gnl|my_center|LOCUS_00040 4079 3159 gene locus_tag LOCUS_00050 gene tsf 4079 3159 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384678.1 protein_id gnl|my_center|LOCUS_00050 4926 4198 gene locus_tag LOCUS_00060 gene rpsB 4926 4198 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_00060 7492 5525 gene locus_tag LOCUS_00070 7492 5525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7875 9509 gene locus_tag LOCUS_00080 7875 9509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9547 10950 gene locus_tag LOCUS_00090 9547 10950 CDS product MBOAT family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035887521.1 protein_id gnl|my_center|LOCUS_00090 10963 12360 gene locus_tag LOCUS_00100 10963 12360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 12383 13000 gene locus_tag LOCUS_00110 12383 13000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 13012 14712 gene locus_tag LOCUS_00120 13012 14712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 16489 14903 gene locus_tag LOCUS_00130 16489 14903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 17606 16521 gene locus_tag LOCUS_00140 17606 16521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 18625 18005 gene locus_tag LOCUS_00150 18625 18005 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765580.1 protein_id gnl|my_center|LOCUS_00150 20642 18735 gene locus_tag LOCUS_00160 20642 18735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 21270 20656 gene locus_tag LOCUS_00170 21270 20656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 21479 21267 gene locus_tag LOCUS_00180 21479 21267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 21857 21498 gene locus_tag LOCUS_00190 21857 21498 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965540.1 protein_id gnl|my_center|LOCUS_00190 22109 23134 gene locus_tag LOCUS_00200 22109 23134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 23192 24595 gene locus_tag LOCUS_00210 23192 24595 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_00210 24608 25726 gene locus_tag LOCUS_00220 24608 25726 CDS product DHHW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138263010.1 protein_id gnl|my_center|LOCUS_00220 28067 27621 gene locus_tag LOCUS_00230 28067 27621 CDS product RbsD/FucU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993892.1 protein_id gnl|my_center|LOCUS_00230 29928 28117 gene locus_tag LOCUS_00240 gene fucI 29928 28117 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107686.1 protein_id gnl|my_center|LOCUS_00240 31000 30023 gene locus_tag LOCUS_00250 31000 30023 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_00250 31334 32842 gene locus_tag LOCUS_00260 gene gguA 31334 32842 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 protein_id gnl|my_center|LOCUS_00260 32839 33831 gene locus_tag LOCUS_00270 32839 33831 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582801.1 protein_id gnl|my_center|LOCUS_00270 33905 35059 gene locus_tag LOCUS_00280 33905 35059 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582802.1 protein_id gnl|my_center|LOCUS_00280 35190 36665 gene locus_tag LOCUS_00290 35190 36665 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258145.1 protein_id gnl|my_center|LOCUS_00290 36679 37557 gene locus_tag LOCUS_00300 gene srlD 36679 37557 CDS product sorbitol-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582810.1 protein_id gnl|my_center|LOCUS_00300 37567 38736 gene locus_tag LOCUS_00310 37567 38736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 38772 40031 gene locus_tag LOCUS_00320 38772 40031 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853230.1 protein_id gnl|my_center|LOCUS_00320 40086 41663 gene locus_tag LOCUS_00330 40086 41663 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_00330 42363 41734 gene locus_tag LOCUS_00340 42363 41734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 42587 42895 gene locus_tag LOCUS_00350 42587 42895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 42896 43345 gene locus_tag LOCUS_00360 42896 43345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 43376 45565 gene locus_tag LOCUS_00370 43376 45565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 45583 47034 gene locus_tag LOCUS_00380 45583 47034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 47178 47786 gene locus_tag LOCUS_00390 47178 47786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 47833 48288 gene locus_tag LOCUS_00400 47833 48288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 48282 48512 gene locus_tag LOCUS_00410 gene csrA 48282 48512 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987028.1 protein_id gnl|my_center|LOCUS_00410 48948 49346 gene locus_tag LOCUS_00420 gene flgB 48948 49346 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245656.1 protein_id gnl|my_center|LOCUS_00420 49427 49891 gene locus_tag LOCUS_00430 gene flgC 49427 49891 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965463.1 protein_id gnl|my_center|LOCUS_00430 50027 50332 gene locus_tag LOCUS_00440 50027 50332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 50367 52016 gene locus_tag LOCUS_00450 50367 52016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 52009 53025 gene locus_tag LOCUS_00460 gene fliG 52009 53025 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082903.1 protein_id gnl|my_center|LOCUS_00460 53018 53878 gene locus_tag LOCUS_00470 53018 53878 CDS product FliH/SctL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392294.1 protein_id gnl|my_center|LOCUS_00470 53891 55192 gene locus_tag LOCUS_00480 gene fliI 53891 55192 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460756.1 protein_id gnl|my_center|LOCUS_00480 55292 55744 gene locus_tag LOCUS_00490 55292 55744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 55804 56343 gene locus_tag LOCUS_00500 55804 56343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 56350 57522 gene locus_tag LOCUS_00510 56350 57522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 57544 58134 gene locus_tag LOCUS_00520 57544 58134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 58206 58592 gene locus_tag LOCUS_00530 58206 58592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 58682 59983 gene locus_tag LOCUS_00540 58682 59983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 60165 60380 gene locus_tag LOCUS_00550 60165 60380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 60519 61343 gene locus_tag LOCUS_00560 60519 61343 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556880.1 protein_id gnl|my_center|LOCUS_00560 61376 62236 gene locus_tag LOCUS_00570 61376 62236 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393242.1 protein_id gnl|my_center|LOCUS_00570 62278 63267 gene locus_tag LOCUS_00580 gene fliM 62278 63267 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183958.1 protein_id gnl|my_center|LOCUS_00580 63288 64541 gene locus_tag LOCUS_00590 63288 64541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 64604 64969 gene locus_tag LOCUS_00600 64604 64969 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359271.1 protein_id gnl|my_center|LOCUS_00600 64969 65343 gene locus_tag LOCUS_00610 64969 65343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 65380 66054 gene locus_tag LOCUS_00620 65380 66054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 66064 66327 gene locus_tag LOCUS_00630 gene fliQ 66064 66327 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816214.1 protein_id gnl|my_center|LOCUS_00630 66341 67105 gene locus_tag LOCUS_00640 gene fliR 66341 67105 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392309.1 protein_id gnl|my_center|LOCUS_00640 67145 68206 gene locus_tag LOCUS_00650 gene flhB 67145 68206 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_00650 68265 70388 gene locus_tag LOCUS_00660 gene flhA 68265 70388 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231947.1 protein_id gnl|my_center|LOCUS_00660 70385 71203 gene locus_tag LOCUS_00670 70385 71203 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087453.1 protein_id gnl|my_center|LOCUS_00670 71230 71985 gene locus_tag LOCUS_00680 gene flgF 71230 71985 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869895.1 protein_id gnl|my_center|LOCUS_00680 72016 72795 gene locus_tag LOCUS_00690 gene flgG 72016 72795 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720227.1 protein_id gnl|my_center|LOCUS_00690 72828 73451 gene locus_tag LOCUS_00700 72828 73451 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006874833.1 protein_id gnl|my_center|LOCUS_00700 73444 73929 gene locus_tag LOCUS_00710 73444 73929 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816201.1 protein_id gnl|my_center|LOCUS_00710 73987 74910 gene locus_tag LOCUS_00720 73987 74910 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721810.1 protein_id gnl|my_center|LOCUS_00720 75252 75449 gene locus_tag LOCUS_00730 75252 75449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 75388 75777 gene locus_tag LOCUS_00740 75388 75777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641754.1 protein_id gnl|my_center|LOCUS_00740 76129 81861 gene locus_tag LOCUS_00750 76129 81861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 82221 81958 gene locus_tag LOCUS_00760 82221 81958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 83608 82124 gene locus_tag LOCUS_00770 83608 82124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 83834 84250 gene locus_tag LOCUS_00780 83834 84250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00780 84467 84318 gene locus_tag LOCUS_00790 84467 84318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 84713 84853 gene locus_tag LOCUS_00800 84713 84853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 84879 85283 gene locus_tag LOCUS_00810 84879 85283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 85333 85488 gene locus_tag LOCUS_00820 85333 85488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 85525 87195 gene locus_tag LOCUS_00830 85525 87195 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_00830 87220 87399 gene locus_tag LOCUS_00840 87220 87399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 87593 89083 gene locus_tag LOCUS_00850 87593 89083 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812813.1 protein_id gnl|my_center|LOCUS_00850 90256 89219 gene locus_tag LOCUS_00860 90256 89219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 91970 90633 gene locus_tag LOCUS_00870 91970 90633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 92004 92207 gene locus_tag LOCUS_00880 92004 92207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 93070 93654 gene locus_tag LOCUS_00890 93070 93654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 93689 94333 gene locus_tag LOCUS_00900 93689 94333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 94353 95714 gene locus_tag LOCUS_00910 94353 95714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 96030 96377 gene locus_tag LOCUS_00920 96030 96377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 96379 97095 gene locus_tag LOCUS_00930 96379 97095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 97147 97611 gene locus_tag LOCUS_00940 97147 97611 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368727.1 protein_id gnl|my_center|LOCUS_00940 97598 97732 gene locus_tag LOCUS_00950 97598 97732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 97729 98709 gene locus_tag LOCUS_00960 97729 98709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 98806 98970 gene locus_tag LOCUS_00970 98806 98970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 99117 99329 gene locus_tag LOCUS_00980 99117 99329 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885335.1 protein_id gnl|my_center|LOCUS_00980 99348 99692 gene locus_tag LOCUS_00990 99348 99692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 99770 101095 gene locus_tag LOCUS_01000 99770 101095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 101092 101829 gene locus_tag LOCUS_01010 101092 101829 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721674.1 protein_id gnl|my_center|LOCUS_01010 101769 101987 gene locus_tag LOCUS_01020 101769 101987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 101956 102135 gene locus_tag LOCUS_01030 101956 102135 CDS product DUF6440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895603.1 protein_id gnl|my_center|LOCUS_01030 102721 102119 gene locus_tag LOCUS_01040 102721 102119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 103111 102779 gene locus_tag LOCUS_01050 103111 102779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 103962 103108 gene locus_tag LOCUS_01060 103962 103108 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287519.1 protein_id gnl|my_center|LOCUS_01060 104552 103959 gene locus_tag LOCUS_01070 104552 103959 CDS product Abortive infection protein AbiEi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072726816.1 protein_id gnl|my_center|LOCUS_01070 104996 104685 gene locus_tag LOCUS_01080 gene mobC 104996 104685 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368707.1 protein_id gnl|my_center|LOCUS_01080 105184 105026 gene locus_tag LOCUS_01090 105184 105026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 106002 105157 gene locus_tag LOCUS_01100 106002 105157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 106780 105959 gene locus_tag LOCUS_01110 106780 105959 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355976.1 protein_id gnl|my_center|LOCUS_01110 108209 108006 gene locus_tag LOCUS_01120 108209 108006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 108639 108181 gene locus_tag LOCUS_01130 108639 108181 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358449.1 protein_id gnl|my_center|LOCUS_01130 109434 109189 gene locus_tag LOCUS_01140 109434 109189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 109668 109444 gene locus_tag LOCUS_01150 109668 109444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948872.1 protein_id gnl|my_center|LOCUS_01150 109748 110095 gene locus_tag LOCUS_01160 109748 110095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 111100 110354 gene locus_tag LOCUS_01170 111100 110354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 111327 111097 gene locus_tag LOCUS_01180 111327 111097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 111929 111339 gene locus_tag LOCUS_01190 111929 111339 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948871.1 protein_id gnl|my_center|LOCUS_01190 112439 112696 gene locus_tag LOCUS_01200 112439 112696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 112701 114332 gene locus_tag LOCUS_01210 gene tndX 112701 114332 CDS product site-specific resolvase TndX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324544.1 protein_id gnl|my_center|LOCUS_01210 115797 114601 gene locus_tag LOCUS_01220 115797 114601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 115959 116102 gene locus_tag LOCUS_01230 115959 116102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 116470 116117 gene locus_tag LOCUS_01240 116470 116117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 116792 116457 gene locus_tag LOCUS_01250 116792 116457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 116996 117214 gene locus_tag LOCUS_01260 116996 117214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 117363 117563 gene locus_tag LOCUS_01270 117363 117563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 117786 117538 gene locus_tag LOCUS_01280 117786 117538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 117985 118200 gene locus_tag LOCUS_01290 117985 118200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 118222 118458 gene locus_tag LOCUS_01300 118222 118458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 118451 118990 gene locus_tag LOCUS_01310 118451 118990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 118987 119355 gene locus_tag LOCUS_01320 118987 119355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 119348 119686 gene locus_tag LOCUS_01330 119348 119686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 119693 120457 gene locus_tag LOCUS_01340 119693 120457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 120591 120971 gene locus_tag LOCUS_01350 120591 120971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 120985 122739 gene locus_tag LOCUS_01360 120985 122739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 122736 123998 gene locus_tag LOCUS_01370 122736 123998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 124093 126018 gene locus_tag LOCUS_01380 124093 126018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 126443 126997 gene locus_tag LOCUS_01390 126443 126997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 126994 127548 gene locus_tag LOCUS_01400 126994 127548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 127561 127917 gene locus_tag LOCUS_01410 127561 127917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 127910 128194 gene locus_tag LOCUS_01420 127910 128194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 128191 128937 gene locus_tag LOCUS_01430 128191 128937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 128941 129261 gene locus_tag LOCUS_01440 128941 129261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 129248 129403 gene locus_tag LOCUS_01450 129248 129403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 129385 129705 gene locus_tag LOCUS_01460 129385 129705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 129745 130068 gene locus_tag LOCUS_01470 129745 130068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 130160 130642 gene locus_tag LOCUS_01480 130160 130642 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458833.1 protein_id gnl|my_center|LOCUS_01480 130624 130818 gene locus_tag LOCUS_01490 130624 130818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 131013 131609 gene locus_tag LOCUS_01500 131013 131609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 131640 133592 gene locus_tag LOCUS_01510 131640 133592 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104537.1 protein_id gnl|my_center|LOCUS_01510 133659 133841 gene locus_tag LOCUS_01520 133659 133841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 133956 134345 gene locus_tag LOCUS_01530 133956 134345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 134633 134869 gene locus_tag LOCUS_01540 134633 134869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 134944 135204 gene locus_tag LOCUS_01550 134944 135204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 135272 135445 gene locus_tag LOCUS_01560 135272 135445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 135557 135769 gene locus_tag LOCUS_01570 135557 135769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 135797 136024 gene locus_tag LOCUS_01580 135797 136024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 136008 136508 gene locus_tag LOCUS_01590 136008 136508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 136770 138191 gene locus_tag LOCUS_01600 136770 138191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 138188 139501 gene locus_tag LOCUS_01610 138188 139501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 139505 139882 gene locus_tag LOCUS_01620 139505 139882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 139901 140971 gene locus_tag LOCUS_01630 139901 140971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 140973 141449 gene locus_tag LOCUS_01640 140973 141449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 141446 141811 gene locus_tag LOCUS_01650 141446 141811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 141808 142542 gene locus_tag LOCUS_01660 141808 142542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 142547 143125 gene locus_tag LOCUS_01670 142547 143125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 143055 143357 gene locus_tag LOCUS_01680 143055 143357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 143370 144824 gene locus_tag LOCUS_01690 143370 144824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 144909 145430 gene locus_tag LOCUS_01700 144909 145430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 145496 145900 gene locus_tag LOCUS_01710 145496 145900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 145936 146070 gene locus_tag LOCUS_01720 145936 146070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 146060 149530 gene locus_tag LOCUS_01730 146060 149530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 149530 149745 gene locus_tag LOCUS_01740 149530 149745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 149738 150799 gene locus_tag LOCUS_01750 149738 150799 CDS product contractile injection system protein, VgrG/Pvc8 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808005.1 protein_id gnl|my_center|LOCUS_01750 150799 151164 gene locus_tag LOCUS_01760 150799 151164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 151178 151576 gene locus_tag LOCUS_01770 151178 151576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 151579 151899 gene locus_tag LOCUS_01780 151579 151899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 151892 153028 gene locus_tag LOCUS_01790 151892 153028 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272381.1 protein_id gnl|my_center|LOCUS_01790 153021 154073 gene locus_tag LOCUS_01800 153021 154073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 154057 156828 gene locus_tag LOCUS_01810 154057 156828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 157024 157488 gene locus_tag LOCUS_01820 157024 157488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 157947 159125 gene locus_tag LOCUS_01830 157947 159125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 159080 159415 gene locus_tag LOCUS_01840 159080 159415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 159433 159597 gene locus_tag LOCUS_01850 159433 159597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 159601 160044 gene locus_tag LOCUS_01860 159601 160044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 160109 160441 gene locus_tag LOCUS_01870 160109 160441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 160457 160735 gene locus_tag LOCUS_01880 160457 160735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 160750 162438 gene locus_tag LOCUS_01890 160750 162438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 162459 163052 gene locus_tag LOCUS_01900 162459 163052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 163568 163197 gene locus_tag LOCUS_01910 163568 163197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 164098 163637 gene locus_tag LOCUS_01920 164098 163637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 164318 164497 gene locus_tag LOCUS_01930 164318 164497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 164959 164786 gene locus_tag LOCUS_01940 164959 164786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 165211 164972 gene locus_tag LOCUS_01950 165211 164972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 165477 165208 gene locus_tag LOCUS_01960 165477 165208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 165661 165524 gene locus_tag LOCUS_01970 165661 165524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 165918 165784 gene locus_tag LOCUS_01980 165918 165784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 166089 166298 gene locus_tag LOCUS_01990 166089 166298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 167099 166695 gene locus_tag LOCUS_02000 gene rpsI 167099 166695 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357662.1 protein_id gnl|my_center|LOCUS_02000 167545 167114 gene locus_tag LOCUS_02010 gene rplM 167545 167114 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459272.1 protein_id gnl|my_center|LOCUS_02010 167852 168616 gene locus_tag LOCUS_02020 167852 168616 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947991.1 protein_id gnl|my_center|LOCUS_02020 168620 169699 gene locus_tag LOCUS_02030 168620 169699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 171258 169927 gene locus_tag LOCUS_02040 171258 169927 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_02040 171451 171248 gene locus_tag LOCUS_02050 171451 171248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 171599 172468 gene locus_tag LOCUS_02060 171599 172468 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454079.1 protein_id gnl|my_center|LOCUS_02060 172545 173069 gene locus_tag LOCUS_02070 172545 173069 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357951.1 protein_id gnl|my_center|LOCUS_02070 173083 173955 gene locus_tag LOCUS_02080 173083 173955 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_02080 173960 174481 gene locus_tag LOCUS_02090 173960 174481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 174497 175438 gene locus_tag LOCUS_02100 gene prmA 174497 175438 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816472.1 protein_id gnl|my_center|LOCUS_02100 175435 176424 gene locus_tag LOCUS_02110 175435 176424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 178246 176576 gene locus_tag LOCUS_02120 178246 176576 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861938.1 protein_id gnl|my_center|LOCUS_02120 178519 178358 gene locus_tag LOCUS_02130 178519 178358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 178808 178629 gene locus_tag LOCUS_02140 178808 178629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 179176 178757 gene locus_tag LOCUS_02150 179176 178757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 179331 179735 gene locus_tag LOCUS_02160 179331 179735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 179892 182057 gene locus_tag LOCUS_02170 179892 182057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 182118 183332 gene locus_tag LOCUS_02180 182118 183332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 183335 183673 gene locus_tag LOCUS_02190 gene mobC 183335 183673 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368707.1 protein_id gnl|my_center|LOCUS_02190 184022 183717 gene locus_tag LOCUS_02200 184022 183717 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944876.1 protein_id gnl|my_center|LOCUS_02200 184139 184573 gene locus_tag LOCUS_02210 184139 184573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 184651 184956 gene locus_tag LOCUS_02220 184651 184956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 185018 186433 gene locus_tag LOCUS_02230 185018 186433 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368703.1 protein_id gnl|my_center|LOCUS_02230 187538 186651 gene locus_tag LOCUS_02240 187538 186651 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_02240 188139 187555 gene locus_tag LOCUS_02250 188139 187555 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457452.1 protein_id gnl|my_center|LOCUS_02250 188418 188711 gene locus_tag LOCUS_02260 188418 188711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 189010 188822 gene locus_tag LOCUS_02270 189010 188822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 190928 189183 gene locus_tag LOCUS_02280 190928 189183 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682224.1 protein_id gnl|my_center|LOCUS_02280 192709 190922 gene locus_tag LOCUS_02290 192709 190922 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460630.1 protein_id gnl|my_center|LOCUS_02290 192925 193545 gene locus_tag LOCUS_02300 192925 193545 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681311.1 protein_id gnl|my_center|LOCUS_02300 193955 193605 gene locus_tag LOCUS_02310 193955 193605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 195792 194062 gene locus_tag LOCUS_02320 195792 194062 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065725.1 protein_id gnl|my_center|LOCUS_02320 197564 195789 gene locus_tag LOCUS_02330 197564 195789 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048173276.1 protein_id gnl|my_center|LOCUS_02330 197821 197561 gene locus_tag LOCUS_02340 197821 197561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 198973 197945 gene locus_tag LOCUS_02350 198973 197945 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986747.1 protein_id gnl|my_center|LOCUS_02350 199301 199014 gene locus_tag LOCUS_02360 199301 199014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 199541 199732 gene locus_tag LOCUS_02370 199541 199732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 200113 199817 gene locus_tag LOCUS_02380 200113 199817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 201851 200166 gene locus_tag LOCUS_02390 201851 200166 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_02390 202235 201969 gene locus_tag LOCUS_02400 202235 201969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 202563 202360 gene locus_tag LOCUS_02410 202563 202360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 203321 202911 gene locus_tag LOCUS_02420 203321 202911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 204021 203833 gene locus_tag LOCUS_02430 204021 203833 CDS product cysteine-rich KTR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001803271.1 protein_id gnl|my_center|LOCUS_02430 204461 204021 gene locus_tag LOCUS_02440 204461 204021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 205223 204474 gene locus_tag LOCUS_02450 205223 204474 CDS product DUF2087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891335.1 protein_id gnl|my_center|LOCUS_02450 205377 205736 gene locus_tag LOCUS_02460 205377 205736 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324548.1 protein_id gnl|my_center|LOCUS_02460 206701 205928 gene locus_tag LOCUS_02470 206701 205928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 206900 206628 gene locus_tag LOCUS_02480 206900 206628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 207568 206897 gene locus_tag LOCUS_02490 207568 206897 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948592.1 protein_id gnl|my_center|LOCUS_02490 208245 207877 gene locus_tag LOCUS_02500 208245 207877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 208837 208646 gene locus_tag LOCUS_02510 208837 208646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 209795 209043 gene locus_tag LOCUS_02520 209795 209043 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861012.1 protein_id gnl|my_center|LOCUS_02520 210205 209798 gene locus_tag LOCUS_02530 210205 209798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 210791 210225 gene locus_tag LOCUS_02540 210791 210225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 211407 210949 gene locus_tag LOCUS_02550 211407 210949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 212047 212562 gene locus_tag LOCUS_02560 212047 212562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 212723 213184 gene locus_tag LOCUS_02570 212723 213184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 213192 214925 gene locus_tag LOCUS_02580 213192 214925 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798723.1 protein_id gnl|my_center|LOCUS_02580 214925 216991 gene locus_tag LOCUS_02590 214925 216991 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389613.1 protein_id gnl|my_center|LOCUS_02590 217632 217141 gene locus_tag LOCUS_02600 217632 217141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 218539 217784 gene locus_tag LOCUS_02610 218539 217784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 218993 218526 gene locus_tag LOCUS_02620 218993 218526 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868208.1 protein_id gnl|my_center|LOCUS_02620 219338 219414 gene locus_tag LOCUS_t00020 219338 219414 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 219861 219520 gene locus_tag LOCUS_02630 219861 219520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 220364 219993 gene locus_tag LOCUS_02640 220364 219993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 221971 220823 gene locus_tag LOCUS_02650 221971 220823 CDS product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948721.1 protein_id gnl|my_center|LOCUS_02650 222766 222014 gene locus_tag LOCUS_02660 222766 222014 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889549.1 protein_id gnl|my_center|LOCUS_02660 223747 222770 gene locus_tag LOCUS_02670 gene yclO 223747 222770 CDS product petrobactin ABC transporter permease YclO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246705.1 protein_id gnl|my_center|LOCUS_02670 224751 223744 gene locus_tag LOCUS_02680 224751 223744 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948718.1 protein_id gnl|my_center|LOCUS_02680 225334 224894 gene locus_tag LOCUS_02690 225334 224894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 225464 225324 gene locus_tag LOCUS_02700 225464 225324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 225580 225443 gene locus_tag LOCUS_02710 225580 225443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 225642 226448 gene locus_tag LOCUS_02720 225642 226448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 227728 226586 gene locus_tag LOCUS_02730 227728 226586 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_02730 228032 229702 gene locus_tag LOCUS_02740 228032 229702 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080960.1 protein_id gnl|my_center|LOCUS_02740 230759 229968 gene locus_tag LOCUS_02750 230759 229968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 231460 230765 gene locus_tag LOCUS_02760 231460 230765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 232361 231474 gene locus_tag LOCUS_02770 232361 231474 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560935.1 protein_id gnl|my_center|LOCUS_02770 232747 232358 gene locus_tag LOCUS_02780 232747 232358 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805188.1 protein_id gnl|my_center|LOCUS_02780 234096 233029 gene locus_tag LOCUS_02790 234096 233029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 235242 234178 gene locus_tag LOCUS_02800 235242 234178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 236731 235256 gene locus_tag LOCUS_02810 236731 235256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 238047 236734 gene locus_tag LOCUS_02820 238047 236734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 239151 238066 gene locus_tag LOCUS_02830 239151 238066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 240477 239170 gene locus_tag LOCUS_02840 240477 239170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 241996 240641 gene locus_tag LOCUS_02850 241996 240641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 243090 242173 gene locus_tag LOCUS_02860 243090 242173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 243458 243090 gene locus_tag LOCUS_02870 243458 243090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 243721 244440 gene locus_tag LOCUS_02880 243721 244440 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546254.1 protein_id gnl|my_center|LOCUS_02880 244453 244992 gene locus_tag LOCUS_02890 244453 244992 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_02890 244976 245551 gene locus_tag LOCUS_02900 244976 245551 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834298.1 protein_id gnl|my_center|LOCUS_02900 245781 245608 gene locus_tag LOCUS_02910 245781 245608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 245901 247091 gene locus_tag LOCUS_02920 gene mltG 245901 247091 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438164.1 protein_id gnl|my_center|LOCUS_02920 247139 248353 gene locus_tag LOCUS_02930 247139 248353 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_02930 250044 248734 gene locus_tag LOCUS_02940 250044 248734 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_02940 250510 250304 gene locus_tag LOCUS_02950 250510 250304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 252108 250528 gene locus_tag LOCUS_02960 252108 250528 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861896.1 protein_id gnl|my_center|LOCUS_02960 252552 253682 gene locus_tag LOCUS_02970 252552 253682 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167773.1 protein_id gnl|my_center|LOCUS_02970 255013 253811 gene locus_tag LOCUS_02980 255013 253811 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 protein_id gnl|my_center|LOCUS_02980 255923 255177 gene locus_tag LOCUS_02990 255923 255177 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529927.1 protein_id gnl|my_center|LOCUS_02990 256737 255967 gene locus_tag LOCUS_03000 256737 255967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 257017 257307 gene locus_tag LOCUS_03010 257017 257307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 257282 257704 gene locus_tag LOCUS_03020 257282 257704 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476578.1 protein_id gnl|my_center|LOCUS_03020 257692 257949 gene locus_tag LOCUS_03030 257692 257949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 258199 259794 gene locus_tag LOCUS_03040 258199 259794 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_03040 259900 260805 gene locus_tag LOCUS_03050 259900 260805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 260818 261438 gene locus_tag LOCUS_03060 260818 261438 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935569.1 protein_id gnl|my_center|LOCUS_03060 261586 262203 gene locus_tag LOCUS_03070 gene lexA 261586 262203 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091617684.1 protein_id gnl|my_center|LOCUS_03070 262644 262832 gene locus_tag LOCUS_03080 262644 262832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 262829 263248 gene locus_tag LOCUS_03090 262829 263248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 263262 263552 gene locus_tag LOCUS_03100 263262 263552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 263581 266265 gene locus_tag LOCUS_03110 gene alaS 263581 266265 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_03110 266269 266808 gene locus_tag LOCUS_03120 266269 266808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 266821 267342 gene locus_tag LOCUS_03130 gene cbrC 266821 267342 CDS product PF03691 family colicin E2 tolerance protein CbrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193070.1 protein_id gnl|my_center|LOCUS_03130 267358 267531 gene locus_tag LOCUS_03140 267358 267531 CDS product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766883.1 protein_id gnl|my_center|LOCUS_03140 269946 267634 gene locus_tag LOCUS_03150 269946 267634 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964222.1 protein_id gnl|my_center|LOCUS_03150 270735 270043 gene locus_tag LOCUS_03160 270735 270043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 272120 270939 gene locus_tag LOCUS_03170 272120 270939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 272879 272127 gene locus_tag LOCUS_03180 gene truA 272879 272127 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435654.1 protein_id gnl|my_center|LOCUS_03180 273834 273025 gene locus_tag LOCUS_03190 273834 273025 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_03190 274698 273835 gene locus_tag LOCUS_03200 274698 273835 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_03200 275586 274744 gene locus_tag LOCUS_03210 275586 274744 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226187.1 protein_id gnl|my_center|LOCUS_03210 276660 275797 gene locus_tag LOCUS_03220 276660 275797 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_03220 276804 277517 gene locus_tag LOCUS_03230 276804 277517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 277827 279119 gene locus_tag LOCUS_03240 277827 279119 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393792.1 protein_id gnl|my_center|LOCUS_03240 279182 281038 gene locus_tag LOCUS_03250 279182 281038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 281061 282182 gene locus_tag LOCUS_03260 281061 282182 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815048.1 protein_id gnl|my_center|LOCUS_03260 282328 283275 gene locus_tag LOCUS_03270 282328 283275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 283456 285174 gene locus_tag LOCUS_03280 283456 285174 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425090.1 protein_id gnl|my_center|LOCUS_03280 285253 287808 gene locus_tag LOCUS_03290 285253 287808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 288801 287965 gene locus_tag LOCUS_03300 288801 287965 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901831.1 protein_id gnl|my_center|LOCUS_03300 289341 290048 gene locus_tag LOCUS_03310 289341 290048 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_03310 290048 291673 gene locus_tag LOCUS_03320 290048 291673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 291670 292155 gene locus_tag LOCUS_03330 291670 292155 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964330.1 protein_id gnl|my_center|LOCUS_03330 295504 292838 gene locus_tag LOCUS_03340 295504 292838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 295928 295806 gene locus_tag LOCUS_03350 295928 295806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 296115 297335 gene locus_tag LOCUS_03360 gene ilvA 296115 297335 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017132.1 protein_id gnl|my_center|LOCUS_03360 297548 298192 gene locus_tag LOCUS_03370 gene rpe 297548 298192 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480039.1 protein_id gnl|my_center|LOCUS_03370 298374 298976 gene locus_tag LOCUS_03380 gene recR 298374 298976 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963454.1 protein_id gnl|my_center|LOCUS_03380 298987 299667 gene locus_tag LOCUS_03390 298987 299667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 300262 299711 gene locus_tag LOCUS_03400 300262 299711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 300622 300278 gene locus_tag LOCUS_03410 300622 300278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 301468 300755 gene locus_tag LOCUS_03420 gene sfsA 301468 300755 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461735.1 protein_id gnl|my_center|LOCUS_03420 301733 302635 gene locus_tag LOCUS_03430 301733 302635 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904266.1 protein_id gnl|my_center|LOCUS_03430 302690 303274 gene locus_tag LOCUS_03440 302690 303274 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965241.1 protein_id gnl|my_center|LOCUS_03440 303467 304234 gene locus_tag LOCUS_03450 303467 304234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 304734 304273 gene locus_tag LOCUS_03460 304734 304273 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459496.1 protein_id gnl|my_center|LOCUS_03460 304931 306229 gene locus_tag LOCUS_03470 304931 306229 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884296.1 protein_id gnl|my_center|LOCUS_03470 306226 307062 gene locus_tag LOCUS_03480 306226 307062 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948342.1 protein_id gnl|my_center|LOCUS_03480 307234 308481 gene locus_tag LOCUS_03490 gene gltS 307234 308481 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903453.1 protein_id gnl|my_center|LOCUS_03490 309064 308507 gene locus_tag LOCUS_03500 309064 308507 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_03500 309576 309061 gene locus_tag LOCUS_03510 309576 309061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 310770 309706 gene locus_tag LOCUS_03520 310770 309706 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838850.1 protein_id gnl|my_center|LOCUS_03520 311778 310924 gene locus_tag LOCUS_03530 311778 310924 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060947.1 protein_id gnl|my_center|LOCUS_03530 312281 311775 gene locus_tag LOCUS_03540 312281 311775 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888598.1 protein_id gnl|my_center|LOCUS_03540 312280 312465 gene locus_tag LOCUS_03550 312280 312465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 312518 313333 gene locus_tag LOCUS_03560 312518 313333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 317109 313435 gene locus_tag LOCUS_03570 gene nifJ 317109 313435 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391612.1 protein_id gnl|my_center|LOCUS_03570 318147 317455 gene locus_tag LOCUS_03580 318147 317455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 318331 319848 gene locus_tag LOCUS_03590 318331 319848 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257250.1 protein_id gnl|my_center|LOCUS_03590 320583 320311 gene locus_tag LOCUS_03600 320583 320311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03600 320814 320599 gene locus_tag LOCUS_03610 320814 320599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03610 321303 320890 gene locus_tag LOCUS_03620 321303 320890 CDS product DUF3788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203320.1 protein_id gnl|my_center|LOCUS_03620 321579 321307 gene locus_tag LOCUS_03630 321579 321307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 322566 321661 gene locus_tag LOCUS_03640 322566 321661 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263075.1 protein_id gnl|my_center|LOCUS_03640 323288 322563 gene locus_tag LOCUS_03650 323288 322563 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_03650 324108 323401 gene locus_tag LOCUS_03660 324108 323401 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722035.1 protein_id gnl|my_center|LOCUS_03660 325299 324148 gene locus_tag LOCUS_03670 325299 324148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 325676 326203 gene locus_tag LOCUS_03680 325676 326203 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965709.1 protein_id gnl|my_center|LOCUS_03680 326560 327780 gene locus_tag LOCUS_03690 326560 327780 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461084.1 protein_id gnl|my_center|LOCUS_03690 328121 329587 gene locus_tag LOCUS_03700 328121 329587 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_03700 329596 330648 gene locus_tag LOCUS_03710 329596 330648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 330805 331986 gene locus_tag LOCUS_03720 330805 331986 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987123.1 protein_id gnl|my_center|LOCUS_03720 332288 332028 gene locus_tag LOCUS_03730 332288 332028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 332625 332467 gene locus_tag LOCUS_03740 332625 332467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 334141 332774 gene locus_tag LOCUS_03750 334141 332774 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861760.1 protein_id gnl|my_center|LOCUS_03750 334247 334390 gene locus_tag LOCUS_03760 334247 334390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 334471 335097 gene locus_tag LOCUS_03770 334471 335097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 335111 335689 gene locus_tag LOCUS_03780 335111 335689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 335699 337048 gene locus_tag LOCUS_03790 335699 337048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 337126 337887 gene locus_tag LOCUS_03800 337126 337887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 338005 339135 gene locus_tag LOCUS_03810 338005 339135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 339474 342617 gene locus_tag LOCUS_03820 339474 342617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 342938 343759 gene locus_tag LOCUS_03830 342938 343759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 343957 346461 gene locus_tag LOCUS_03840 gene leuS 343957 346461 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003578174.1 protein_id gnl|my_center|LOCUS_03840 346643 346963 gene locus_tag LOCUS_03850 346643 346963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 347096 347278 gene locus_tag LOCUS_03860 gene rpsU 347096 347278 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964600.1 protein_id gnl|my_center|LOCUS_03860 347347 347946 gene locus_tag LOCUS_03870 347347 347946 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775494.1 protein_id gnl|my_center|LOCUS_03870 349411 348089 gene locus_tag LOCUS_03880 349411 348089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 350093 349467 gene locus_tag LOCUS_03890 350093 349467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 350520 350317 gene locus_tag LOCUS_03900 350520 350317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 351118 351435 gene locus_tag LOCUS_03910 351118 351435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 351554 352642 gene locus_tag LOCUS_03920 gene ychF 351554 352642 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815179.1 protein_id gnl|my_center|LOCUS_03920 353982 353026 gene locus_tag LOCUS_03930 353982 353026 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903111.1 protein_id gnl|my_center|LOCUS_03930 354935 353982 gene locus_tag LOCUS_03940 gene hprK 354935 353982 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_03940 355282 355094 gene locus_tag LOCUS_03950 gene rpmB 355282 355094 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395976.1 protein_id gnl|my_center|LOCUS_03950 355485 358181 gene locus_tag LOCUS_03960 gene polA 355485 358181 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048038.1 protein_id gnl|my_center|LOCUS_03960 358535 358924 gene locus_tag LOCUS_03970 358535 358924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 358914 359195 gene locus_tag LOCUS_03980 358914 359195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 359211 359843 gene locus_tag LOCUS_03990 359211 359843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 360074 360748 gene locus_tag LOCUS_04000 360074 360748 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948733.1 protein_id gnl|my_center|LOCUS_04000 360761 361216 gene locus_tag LOCUS_04010 gene rimI 360761 361216 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434429.1 protein_id gnl|my_center|LOCUS_04010 361318 362328 gene locus_tag LOCUS_04020 gene tsaD 361318 362328 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_04020 365192 362781 gene locus_tag LOCUS_04030 365192 362781 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101845.1 protein_id gnl|my_center|LOCUS_04030 365401 366171 gene locus_tag LOCUS_04040 365401 366171 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922726.1 protein_id gnl|my_center|LOCUS_04040 366187 366933 gene locus_tag LOCUS_04050 366187 366933 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002916109.1 protein_id gnl|my_center|LOCUS_04050 366962 367900 gene locus_tag LOCUS_04060 366962 367900 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392351.1 protein_id gnl|my_center|LOCUS_04060 368324 367974 gene locus_tag LOCUS_04070 368324 367974 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359499.1 protein_id gnl|my_center|LOCUS_04070 370094 368349 gene locus_tag LOCUS_04080 370094 368349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 370536 371000 gene locus_tag LOCUS_04090 370536 371000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 372100 371093 gene locus_tag LOCUS_04100 372100 371093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 372895 372122 gene locus_tag LOCUS_04110 372895 372122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 374274 372892 gene locus_tag LOCUS_04120 374274 372892 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964890.1 protein_id gnl|my_center|LOCUS_04120 375002 374271 gene locus_tag LOCUS_04130 375002 374271 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948727.1 protein_id gnl|my_center|LOCUS_04130 375368 375210 gene locus_tag LOCUS_04140 375368 375210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 375371 375796 gene locus_tag LOCUS_04150 375371 375796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 376376 375969 gene locus_tag LOCUS_04160 376376 375969 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812484.1 protein_id gnl|my_center|LOCUS_04160 376577 376389 gene locus_tag LOCUS_04170 376577 376389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 377204 379855 gene locus_tag LOCUS_04180 377204 379855 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_04180 381105 379915 gene locus_tag LOCUS_04190 gene ugpC 381105 379915 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_04190 382550 381423 gene locus_tag LOCUS_04200 gene nagA 382550 381423 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292242.1 protein_id gnl|my_center|LOCUS_04200 383293 382547 gene locus_tag LOCUS_04210 gene nagB 383293 382547 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437039.1 protein_id gnl|my_center|LOCUS_04210 384213 383359 gene locus_tag LOCUS_04220 384213 383359 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528984.1 protein_id gnl|my_center|LOCUS_04220 385166 384210 gene locus_tag LOCUS_04230 385166 384210 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528983.1 protein_id gnl|my_center|LOCUS_04230 386620 385319 gene locus_tag LOCUS_04240 386620 385319 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528982.1 protein_id gnl|my_center|LOCUS_04240 387672 386821 gene locus_tag LOCUS_04250 387672 386821 CDS product PocR ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721549.1 protein_id gnl|my_center|LOCUS_04250 388805 387690 gene locus_tag LOCUS_04260 388805 387690 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_04260 389729 388809 gene locus_tag LOCUS_04270 389729 388809 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_04270 390875 389856 gene locus_tag LOCUS_04280 gene galE 390875 389856 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_04280 391306 392631 gene locus_tag LOCUS_04290 391306 392631 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015963.1 protein_id gnl|my_center|LOCUS_04290 392691 393566 gene locus_tag LOCUS_04300 392691 393566 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296994.1 protein_id gnl|my_center|LOCUS_04300 394081 393656 gene locus_tag LOCUS_04310 394081 393656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 394407 394210 gene locus_tag LOCUS_04320 394407 394210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 394634 394708 gene locus_tag LOCUS_t00030 394634 394708 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 395054 394929 gene locus_tag LOCUS_04330 395054 394929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 396336 395434 gene locus_tag LOCUS_04340 396336 395434 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167728.1 protein_id gnl|my_center|LOCUS_04340 397406 396366 gene locus_tag LOCUS_04350 397406 396366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 397977 397420 gene locus_tag LOCUS_04360 gene rfbC 397977 397420 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_04360 398993 397974 gene locus_tag LOCUS_04370 398993 397974 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432947.1 protein_id gnl|my_center|LOCUS_04370 400020 398986 gene locus_tag LOCUS_04380 400020 398986 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432947.1 protein_id gnl|my_center|LOCUS_04380 401012 400017 gene locus_tag LOCUS_04390 401012 400017 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432947.1 protein_id gnl|my_center|LOCUS_04390 402104 401028 gene locus_tag LOCUS_04400 402104 401028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 403470 402157 gene locus_tag LOCUS_04410 403470 402157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 405002 403467 gene locus_tag LOCUS_04420 405002 403467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 405847 405011 gene locus_tag LOCUS_04430 405847 405011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 406970 405876 gene locus_tag LOCUS_04440 406970 405876 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460776.1 protein_id gnl|my_center|LOCUS_04440 408098 406989 gene locus_tag LOCUS_04450 408098 406989 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987008.1 protein_id gnl|my_center|LOCUS_04450 408891 408115 gene locus_tag LOCUS_04460 gene rfbF 408891 408115 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257101.1 protein_id gnl|my_center|LOCUS_04460 411041 408888 gene locus_tag LOCUS_04470 411041 408888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 413302 411170 gene locus_tag LOCUS_04480 413302 411170 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121196.1 protein_id gnl|my_center|LOCUS_04480 413642 413436 gene locus_tag LOCUS_04490 413642 413436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 414983 413832 gene locus_tag LOCUS_04500 414983 413832 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166240.1 protein_id gnl|my_center|LOCUS_04500 415509 415585 gene locus_tag LOCUS_t00040 415509 415585 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 415943 416668 gene locus_tag LOCUS_04510 415943 416668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 416942 417142 gene locus_tag LOCUS_04520 416942 417142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 417139 418359 gene locus_tag LOCUS_04530 417139 418359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 418356 419477 gene locus_tag LOCUS_04540 418356 419477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 419471 420595 gene locus_tag LOCUS_04550 419471 420595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 420670 422007 gene locus_tag LOCUS_04560 420670 422007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 422007 423020 gene locus_tag LOCUS_04570 422007 423020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 423013 424182 gene locus_tag LOCUS_04580 423013 424182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 >Feature sequence002 133 468 gene locus_tag LOCUS_04590 133 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 1029 433 gene locus_tag LOCUS_04600 1029 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 1742 1077 gene locus_tag LOCUS_04610 1742 1077 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666310.1 protein_id gnl|my_center|LOCUS_04610 3277 1757 gene locus_tag LOCUS_04620 3277 1757 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_04620 3607 3882 gene locus_tag LOCUS_04630 3607 3882 CDS product late competence development ComFB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391619.1 protein_id gnl|my_center|LOCUS_04630 5294 3924 gene locus_tag LOCUS_04640 5294 3924 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_04640 5432 6244 gene locus_tag LOCUS_04650 5432 6244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 6238 6540 gene locus_tag LOCUS_04660 6238 6540 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596042.1 protein_id gnl|my_center|LOCUS_04660 6679 8241 gene locus_tag LOCUS_04670 gene murJ 6679 8241 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391760.1 protein_id gnl|my_center|LOCUS_04670 8315 9763 gene locus_tag LOCUS_04680 8315 9763 CDS product IctB family putative bicarbonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143733.1 protein_id gnl|my_center|LOCUS_04680 9760 10881 gene locus_tag LOCUS_04690 9760 10881 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121802.1 protein_id gnl|my_center|LOCUS_04690 10881 11384 gene locus_tag LOCUS_04700 10881 11384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 11381 11884 gene locus_tag LOCUS_04710 11381 11884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 11942 14149 gene locus_tag LOCUS_04720 11942 14149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 14146 15132 gene locus_tag LOCUS_04730 14146 15132 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870495.1 protein_id gnl|my_center|LOCUS_04730 15129 15932 gene locus_tag LOCUS_04740 gene znuC 15129 15932 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114128.1 protein_id gnl|my_center|LOCUS_04740 15929 16771 gene locus_tag LOCUS_04750 15929 16771 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903855.1 protein_id gnl|my_center|LOCUS_04750 17411 16962 gene locus_tag LOCUS_04760 17411 16962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 17607 18056 gene locus_tag LOCUS_04770 17607 18056 CDS product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393888.1 protein_id gnl|my_center|LOCUS_04770 18111 19859 gene locus_tag LOCUS_04780 gene argS 18111 19859 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462258.1 protein_id gnl|my_center|LOCUS_04780 19943 20569 gene locus_tag LOCUS_04790 19943 20569 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949003.1 protein_id gnl|my_center|LOCUS_04790 20719 20585 gene locus_tag LOCUS_04800 20719 20585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 20986 20822 gene locus_tag LOCUS_04810 20986 20822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 21638 20988 gene locus_tag LOCUS_04820 21638 20988 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459560.1 protein_id gnl|my_center|LOCUS_04820 22495 21635 gene locus_tag LOCUS_04830 22495 21635 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_04830 22872 22492 gene locus_tag LOCUS_04840 22872 22492 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_04840 23167 23472 gene locus_tag LOCUS_04850 gene spoIIAA 23167 23472 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398633.1 protein_id gnl|my_center|LOCUS_04850 23634 24071 gene locus_tag LOCUS_04860 gene spoIIAB 23634 24071 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_04860 24068 24781 gene locus_tag LOCUS_04870 gene sigF 24068 24781 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230458.1 protein_id gnl|my_center|LOCUS_04870 24926 25189 gene locus_tag LOCUS_04880 24926 25189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 26317 25193 gene locus_tag LOCUS_04890 26317 25193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 26654 26322 gene locus_tag LOCUS_04900 26654 26322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 27614 26670 gene locus_tag LOCUS_04910 gene pyrD 27614 26670 CDS product dihydroorotate oxidase B catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081049.1 protein_id gnl|my_center|LOCUS_04910 28401 27607 gene locus_tag LOCUS_04920 28401 27607 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_04920 29336 28413 gene locus_tag LOCUS_04930 gene pyrF 29336 28413 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_04930 30661 29384 gene locus_tag LOCUS_04940 30661 29384 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861243.1 protein_id gnl|my_center|LOCUS_04940 30841 31032 gene locus_tag LOCUS_04950 30841 31032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 31876 31070 gene locus_tag LOCUS_04960 gene yidA 31876 31070 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295119.1 protein_id gnl|my_center|LOCUS_04960 32060 32860 gene locus_tag LOCUS_04970 32060 32860 CDS product YlmH/Sll1252 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272484.1 protein_id gnl|my_center|LOCUS_04970 32863 33069 gene locus_tag LOCUS_04980 32863 33069 CDS product DUF896 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939394.1 protein_id gnl|my_center|LOCUS_04980 33186 34049 gene locus_tag LOCUS_04990 33186 34049 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538273.1 protein_id gnl|my_center|LOCUS_04990 34306 35460 gene locus_tag LOCUS_05000 34306 35460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 35617 36996 gene locus_tag LOCUS_05010 35617 36996 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142095.1 protein_id gnl|my_center|LOCUS_05010 37409 38587 gene locus_tag LOCUS_05020 37409 38587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 38587 39159 gene locus_tag LOCUS_05030 38587 39159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 39193 39357 gene locus_tag LOCUS_05040 39193 39357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 39491 39700 gene locus_tag LOCUS_05050 39491 39700 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816072.1 protein_id gnl|my_center|LOCUS_05050 39721 40602 gene locus_tag LOCUS_05060 39721 40602 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272300.1 protein_id gnl|my_center|LOCUS_05060 40836 42188 gene locus_tag LOCUS_05070 gene gdhA 40836 42188 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020063.1 protein_id gnl|my_center|LOCUS_05070 42318 43685 gene locus_tag LOCUS_05080 42318 43685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 43682 44965 gene locus_tag LOCUS_05090 43682 44965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 46371 45013 gene locus_tag LOCUS_05100 46371 45013 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108266.1 protein_id gnl|my_center|LOCUS_05100 47412 46444 gene locus_tag LOCUS_05110 47412 46444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 49173 47566 gene locus_tag LOCUS_05120 49173 47566 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963949.1 protein_id gnl|my_center|LOCUS_05120 49367 49194 gene locus_tag LOCUS_05130 49367 49194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 50671 49610 gene locus_tag LOCUS_05140 50671 49610 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_05140 50835 52820 gene locus_tag LOCUS_05150 50835 52820 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_05150 52813 53094 gene locus_tag LOCUS_05160 52813 53094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 53194 53640 gene locus_tag LOCUS_05170 gene rplI 53194 53640 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_05170 53683 55041 gene locus_tag LOCUS_05180 gene dnaB 53683 55041 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_05180 55038 55748 gene locus_tag LOCUS_05190 55038 55748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 56093 55704 gene locus_tag LOCUS_05200 56093 55704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 56097 56510 gene locus_tag LOCUS_05210 56097 56510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 56677 56465 gene locus_tag LOCUS_05220 56677 56465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 56726 57379 gene locus_tag LOCUS_05230 56726 57379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 57442 58833 gene locus_tag LOCUS_05240 gene tilS 57442 58833 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942455.1 protein_id gnl|my_center|LOCUS_05240 58869 59411 gene locus_tag LOCUS_05250 gene hpt 58869 59411 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359412.1 protein_id gnl|my_center|LOCUS_05250 59436 61319 gene locus_tag LOCUS_05260 gene ftsH 59436 61319 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_05260 61410 61486 gene locus_tag LOCUS_t00050 61410 61486 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 66615 62209 gene locus_tag LOCUS_05270 66615 62209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 66750 67082 gene locus_tag LOCUS_05280 66750 67082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 68322 67150 gene locus_tag LOCUS_05290 68322 67150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 69442 68339 gene locus_tag LOCUS_05300 69442 68339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 69867 70055 gene locus_tag LOCUS_05310 69867 70055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 69985 71235 gene locus_tag LOCUS_05320 69985 71235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 71407 72726 gene locus_tag LOCUS_05330 71407 72726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 73153 73374 gene locus_tag LOCUS_05340 73153 73374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 73413 73661 gene locus_tag LOCUS_05350 73413 73661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 73748 75388 gene locus_tag LOCUS_05360 gene tndX 73748 75388 CDS product site-specific resolvase TndX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324544.1 protein_id gnl|my_center|LOCUS_05360 76320 75550 gene locus_tag LOCUS_05370 76320 75550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 76737 76333 gene locus_tag LOCUS_05380 76737 76333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 77706 76900 gene locus_tag LOCUS_05390 77706 76900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 77859 78056 gene locus_tag LOCUS_05400 77859 78056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 78197 78412 gene locus_tag LOCUS_05410 78197 78412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 78464 78649 gene locus_tag LOCUS_05420 78464 78649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 79005 78718 gene locus_tag LOCUS_05430 79005 78718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 79454 79002 gene locus_tag LOCUS_05440 79454 79002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 79850 79596 gene locus_tag LOCUS_05450 79850 79596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 80630 79872 gene locus_tag LOCUS_05460 80630 79872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 80736 80614 gene locus_tag LOCUS_05470 80736 80614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 81116 80727 gene locus_tag LOCUS_05480 81116 80727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 81547 81128 gene locus_tag LOCUS_05490 81547 81128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 81956 81552 gene locus_tag LOCUS_05500 81956 81552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 82390 81953 gene locus_tag LOCUS_05510 82390 81953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 82725 82387 gene locus_tag LOCUS_05520 82725 82387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 83129 82734 gene locus_tag LOCUS_05530 83129 82734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 83154 83741 gene locus_tag LOCUS_05540 83154 83741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 83878 83624 gene locus_tag LOCUS_05550 83878 83624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 83981 85963 gene locus_tag LOCUS_05560 gene gyrB 83981 85963 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080806.1 protein_id gnl|my_center|LOCUS_05560 86178 88421 gene locus_tag LOCUS_05570 gene gyrA 86178 88421 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632827.1 protein_id gnl|my_center|LOCUS_05570 88435 89307 gene locus_tag LOCUS_05580 88435 89307 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583758.1 protein_id gnl|my_center|LOCUS_05580 89391 89981 gene locus_tag LOCUS_05590 89391 89981 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583891.1 protein_id gnl|my_center|LOCUS_05590 89959 91089 gene locus_tag LOCUS_05600 89959 91089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 91236 92402 gene locus_tag LOCUS_05610 91236 92402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 92520 92759 gene locus_tag LOCUS_05620 92520 92759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 92756 93022 gene locus_tag LOCUS_05630 92756 93022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 93400 94572 gene locus_tag LOCUS_05640 93400 94572 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784324.1 protein_id gnl|my_center|LOCUS_05640 94649 96421 gene locus_tag LOCUS_05650 94649 96421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 96425 97501 gene locus_tag LOCUS_05660 96425 97501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 97565 98419 gene locus_tag LOCUS_05670 gene rsmA 97565 98419 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651548.1 protein_id gnl|my_center|LOCUS_05670 98542 100149 gene locus_tag LOCUS_05680 gene pckA 98542 100149 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761973.1 protein_id gnl|my_center|LOCUS_05680 100399 100196 gene locus_tag LOCUS_05690 100399 100196 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965253.1 protein_id gnl|my_center|LOCUS_05690 100805 101737 gene locus_tag LOCUS_05700 100805 101737 CDS product DUF4261 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681717.1 protein_id gnl|my_center|LOCUS_05700 101742 102350 gene locus_tag LOCUS_05710 101742 102350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 103055 102393 gene locus_tag LOCUS_05720 103055 102393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 103253 103549 gene locus_tag LOCUS_05730 103253 103549 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817220.1 protein_id gnl|my_center|LOCUS_05730 103546 104298 gene locus_tag LOCUS_05740 103546 104298 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_05740 104302 105180 gene locus_tag LOCUS_05750 gene hslO 104302 105180 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_05750 106230 105220 gene locus_tag LOCUS_05760 gene pfkA 106230 105220 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963839.1 protein_id gnl|my_center|LOCUS_05760 106487 106562 gene locus_tag LOCUS_t00060 106487 106562 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 106591 106667 gene locus_tag LOCUS_t00070 106591 106667 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 106673 106748 gene locus_tag LOCUS_t00080 106673 106748 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 106783 106858 gene locus_tag LOCUS_t00090 106783 106858 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 106932 107006 gene locus_tag LOCUS_t00100 106932 107006 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 107246 107452 gene locus_tag LOCUS_05770 107246 107452 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418105.1 protein_id gnl|my_center|LOCUS_05770 107449 108033 gene locus_tag LOCUS_05780 107449 108033 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860883.1 protein_id gnl|my_center|LOCUS_05780 108030 109721 gene locus_tag LOCUS_05790 gene cdr 108030 109721 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087552.1 protein_id gnl|my_center|LOCUS_05790 110423 109764 gene locus_tag LOCUS_05800 110423 109764 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_05800 110549 110695 gene locus_tag LOCUS_05810 110549 110695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 110715 110933 gene locus_tag LOCUS_05820 110715 110933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 111472 111299 gene locus_tag LOCUS_05830 111472 111299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05830 112296 111565 gene locus_tag LOCUS_05840 112296 111565 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356430.1 protein_id gnl|my_center|LOCUS_05840 112238 113128 gene locus_tag LOCUS_05850 112238 113128 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920615.1 protein_id gnl|my_center|LOCUS_05850 113144 114028 gene locus_tag LOCUS_05860 113144 114028 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920615.1 protein_id gnl|my_center|LOCUS_05860 114288 114593 gene locus_tag LOCUS_05870 114288 114593 CDS product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116156.1 protein_id gnl|my_center|LOCUS_05870 114594 115091 gene locus_tag LOCUS_05880 114594 115091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 118126 115295 gene locus_tag LOCUS_05890 118126 115295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 118394 119587 gene locus_tag LOCUS_05900 118394 119587 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424103.1 protein_id gnl|my_center|LOCUS_05900 121215 119635 gene locus_tag LOCUS_05910 121215 119635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 124163 121533 gene locus_tag LOCUS_05920 gene ppdK 124163 121533 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_05920 124430 124714 gene locus_tag LOCUS_05930 124430 124714 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229490.1 protein_id gnl|my_center|LOCUS_05930 124760 125671 gene locus_tag LOCUS_05940 gene pfkB 124760 125671 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986316.1 protein_id gnl|my_center|LOCUS_05940 126338 125655 gene locus_tag LOCUS_05950 126338 125655 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170003.1 protein_id gnl|my_center|LOCUS_05950 127445 133093 gene locus_tag LOCUS_05960 127445 133093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 134369 133167 gene locus_tag LOCUS_05970 134369 133167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 134722 136551 gene locus_tag LOCUS_05980 134722 136551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 136611 137288 gene locus_tag LOCUS_05990 136611 137288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 137493 137663 gene locus_tag LOCUS_06000 137493 137663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 138159 140753 gene locus_tag LOCUS_06010 gene clpB 138159 140753 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_06010 141190 141651 gene locus_tag LOCUS_06020 141190 141651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 142390 141632 gene locus_tag LOCUS_06030 gene pxpA 142390 141632 CDS product 5-oxoprolinase subunit PpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234423.1 protein_id gnl|my_center|LOCUS_06030 143515 142463 gene locus_tag LOCUS_06040 143515 142463 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016387.1 protein_id gnl|my_center|LOCUS_06040 144246 143518 gene locus_tag LOCUS_06050 gene pxpB 144246 143518 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889166.1 protein_id gnl|my_center|LOCUS_06050 145654 144323 gene locus_tag LOCUS_06060 145654 144323 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387350.1 protein_id gnl|my_center|LOCUS_06060 145922 146884 gene locus_tag LOCUS_06070 145922 146884 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271954.1 protein_id gnl|my_center|LOCUS_06070 146898 148121 gene locus_tag LOCUS_06080 146898 148121 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082016.1 protein_id gnl|my_center|LOCUS_06080 148218 149393 gene locus_tag LOCUS_06090 148218 149393 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_06090 150300 149383 gene locus_tag LOCUS_06100 150300 149383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 150378 151058 gene locus_tag LOCUS_06110 150378 151058 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066872391.1 protein_id gnl|my_center|LOCUS_06110 152004 151249 gene locus_tag LOCUS_06120 152004 151249 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184185.1 protein_id gnl|my_center|LOCUS_06120 153008 152001 gene locus_tag LOCUS_06130 153008 152001 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461831.1 protein_id gnl|my_center|LOCUS_06130 153790 153011 gene locus_tag LOCUS_06140 153790 153011 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461832.1 protein_id gnl|my_center|LOCUS_06140 154061 153762 gene locus_tag LOCUS_06150 154061 153762 CDS product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461833.1 protein_id gnl|my_center|LOCUS_06150 154598 154338 gene locus_tag LOCUS_06160 154598 154338 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005888910.1 protein_id gnl|my_center|LOCUS_06160 155749 154808 gene locus_tag LOCUS_06170 155749 154808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 156740 155763 gene locus_tag LOCUS_06180 156740 155763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 157156 157719 gene locus_tag LOCUS_06190 157156 157719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 157754 157939 gene locus_tag LOCUS_06200 157754 157939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 157956 158213 gene locus_tag LOCUS_06210 157956 158213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 158715 160478 gene locus_tag LOCUS_06220 158715 160478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 160760 162025 gene locus_tag LOCUS_06230 gene hisD 160760 162025 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861261.1 protein_id gnl|my_center|LOCUS_06230 162304 163065 gene locus_tag LOCUS_06240 gene spo0A 162304 163065 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358896.1 protein_id gnl|my_center|LOCUS_06240 163181 163423 gene locus_tag LOCUS_06250 163181 163423 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761253.1 protein_id gnl|my_center|LOCUS_06250 164094 163720 gene locus_tag LOCUS_06260 164094 163720 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786184.1 protein_id gnl|my_center|LOCUS_06260 165368 164109 gene locus_tag LOCUS_06270 165368 164109 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267047.1 protein_id gnl|my_center|LOCUS_06270 165696 166598 gene locus_tag LOCUS_06280 165696 166598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 166993 168207 gene locus_tag LOCUS_06290 166993 168207 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393768.1 protein_id gnl|my_center|LOCUS_06290 168473 169852 gene locus_tag LOCUS_06300 gene argH 168473 169852 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_06300 169989 171212 gene locus_tag LOCUS_06310 gene argJ 169989 171212 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_06310 171273 172127 gene locus_tag LOCUS_06320 gene argB 171273 172127 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_06320 172140 173063 gene locus_tag LOCUS_06330 gene argF 172140 173063 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_06330 174368 173172 gene locus_tag LOCUS_06340 174368 173172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 174898 174365 gene locus_tag LOCUS_06350 174898 174365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 175356 174991 gene locus_tag LOCUS_06360 175356 174991 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_06360 176840 175677 gene locus_tag LOCUS_06370 gene alr 176840 175677 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_06370 177473 176895 gene locus_tag LOCUS_06380 177473 176895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 179249 177531 gene locus_tag LOCUS_06390 179249 177531 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_06390 179734 179288 gene locus_tag LOCUS_06400 179734 179288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 180651 179734 gene locus_tag LOCUS_06410 180651 179734 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435793.1 protein_id gnl|my_center|LOCUS_06410 180825 180664 gene locus_tag LOCUS_06420 180825 180664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 181559 180831 gene locus_tag LOCUS_06430 181559 180831 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429190.1 protein_id gnl|my_center|LOCUS_06430 181990 181715 gene locus_tag LOCUS_06440 181990 181715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 181989 183143 gene locus_tag LOCUS_06450 181989 183143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 183176 184201 gene locus_tag LOCUS_06460 gene pheS 183176 184201 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436795.1 protein_id gnl|my_center|LOCUS_06460 184475 187180 gene locus_tag LOCUS_06470 184475 187180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 187314 188342 gene locus_tag LOCUS_06480 187314 188342 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966690.1 protein_id gnl|my_center|LOCUS_06480 188449 189462 gene locus_tag LOCUS_06490 gene asnA 188449 189462 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549578.1 protein_id gnl|my_center|LOCUS_06490 189529 190206 gene locus_tag LOCUS_06500 189529 190206 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986274.1 protein_id gnl|my_center|LOCUS_06500 190193 192583 gene locus_tag LOCUS_06510 190193 192583 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_06510 196136 192882 gene locus_tag LOCUS_06520 196136 192882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 198609 196129 gene locus_tag LOCUS_06530 198609 196129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 198838 199179 gene locus_tag LOCUS_06540 198838 199179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 199636 201285 gene locus_tag LOCUS_06550 199636 201285 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_06550 201659 201489 gene locus_tag LOCUS_06560 201659 201489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 202730 201852 gene locus_tag LOCUS_06570 202730 201852 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542436.1 protein_id gnl|my_center|LOCUS_06570 203792 202746 gene locus_tag LOCUS_06580 gene mutY 203792 202746 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243838.1 protein_id gnl|my_center|LOCUS_06580 204517 204149 gene locus_tag LOCUS_06590 204517 204149 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358219.1 protein_id gnl|my_center|LOCUS_06590 206660 204570 gene locus_tag LOCUS_06600 gene recG 206660 204570 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_06600 206852 207784 gene locus_tag LOCUS_06610 206852 207784 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582853.1 protein_id gnl|my_center|LOCUS_06610 209181 207892 gene locus_tag LOCUS_06620 gene hflX 209181 207892 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460362.1 protein_id gnl|my_center|LOCUS_06620 209471 209187 gene locus_tag LOCUS_06630 209471 209187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 209979 209479 gene locus_tag LOCUS_06640 209979 209479 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_06640 210320 210117 gene locus_tag LOCUS_06650 gene rpmE 210320 210117 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462249.1 protein_id gnl|my_center|LOCUS_06650 211329 210436 gene locus_tag LOCUS_06660 211329 210436 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975186.1 protein_id gnl|my_center|LOCUS_06660 211850 213535 gene locus_tag LOCUS_06670 gene leuA 211850 213535 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963596.1 protein_id gnl|my_center|LOCUS_06670 213935 215200 gene locus_tag LOCUS_06680 213935 215200 CDS product DUF3798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868876.1 protein_id gnl|my_center|LOCUS_06680 215299 216900 gene locus_tag LOCUS_06690 215299 216900 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868877.1 protein_id gnl|my_center|LOCUS_06690 216913 218028 gene locus_tag LOCUS_06700 216913 218028 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868878.1 protein_id gnl|my_center|LOCUS_06700 218025 219158 gene locus_tag LOCUS_06710 218025 219158 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868879.1 protein_id gnl|my_center|LOCUS_06710 219155 219649 gene locus_tag LOCUS_06720 219155 219649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 219717 221165 gene locus_tag LOCUS_06730 219717 221165 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987157.1 protein_id gnl|my_center|LOCUS_06730 221170 221883 gene locus_tag LOCUS_06740 221170 221883 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232924.1 protein_id gnl|my_center|LOCUS_06740 223067 221946 gene locus_tag LOCUS_06750 223067 221946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 223492 223277 gene locus_tag LOCUS_06760 223492 223277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 223987 223712 gene locus_tag LOCUS_06770 223987 223712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 225083 224064 gene locus_tag LOCUS_06780 225083 224064 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 protein_id gnl|my_center|LOCUS_06780 227469 225319 gene locus_tag LOCUS_06790 227469 225319 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461496.1 protein_id gnl|my_center|LOCUS_06790 227764 228156 gene locus_tag LOCUS_06800 227764 228156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 228705 228833 gene locus_tag LOCUS_06810 228705 228833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 229011 229664 gene locus_tag LOCUS_06820 229011 229664 CDS product Vat family streptogramin A O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459533.1 protein_id gnl|my_center|LOCUS_06820 229878 230396 gene locus_tag LOCUS_06830 229878 230396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 230585 232576 gene locus_tag LOCUS_06840 230585 232576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 234269 232764 gene locus_tag LOCUS_06850 gene lysS 234269 232764 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861998.1 protein_id gnl|my_center|LOCUS_06850 234767 234294 gene locus_tag LOCUS_06860 gene greA 234767 234294 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_06860 235614 234934 gene locus_tag LOCUS_06870 235614 234934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 235732 236013 gene locus_tag LOCUS_06880 235732 236013 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814556.1 protein_id gnl|my_center|LOCUS_06880 236000 236317 gene locus_tag LOCUS_06890 236000 236317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 237044 236427 gene locus_tag LOCUS_06900 gene spoIIR 237044 236427 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425996.1 protein_id gnl|my_center|LOCUS_06900 237964 237113 gene locus_tag LOCUS_06910 gene ispE 237964 237113 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722719.1 protein_id gnl|my_center|LOCUS_06910 239243 237978 gene locus_tag LOCUS_06920 239243 237978 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_06920 239474 239250 gene locus_tag LOCUS_06930 239474 239250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 240075 239476 gene locus_tag LOCUS_06940 gene thrH 240075 239476 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_06940 241493 240306 gene locus_tag LOCUS_06950 241493 240306 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808537.1 protein_id gnl|my_center|LOCUS_06950 241969 241490 gene locus_tag LOCUS_06960 241969 241490 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968070.1 protein_id gnl|my_center|LOCUS_06960 242727 242951 gene locus_tag LOCUS_06970 242727 242951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 243116 244804 gene locus_tag LOCUS_06980 243116 244804 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_06980 244806 246500 gene locus_tag LOCUS_06990 244806 246500 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_06990 246500 248047 gene locus_tag LOCUS_07000 246500 248047 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775555.1 protein_id gnl|my_center|LOCUS_07000 249503 248445 gene locus_tag LOCUS_07010 249503 248445 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880449.1 protein_id gnl|my_center|LOCUS_07010 249971 249528 gene locus_tag LOCUS_07020 249971 249528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 250434 249964 gene locus_tag LOCUS_07030 250434 249964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 250916 250431 gene locus_tag LOCUS_07040 250916 250431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 251236 250913 gene locus_tag LOCUS_07050 251236 250913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 252286 251243 gene locus_tag LOCUS_07060 252286 251243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 253409 252408 gene locus_tag LOCUS_07070 253409 252408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 253713 254954 gene locus_tag LOCUS_07080 253713 254954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 255077 254916 gene locus_tag LOCUS_07090 255077 254916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 255130 255906 gene locus_tag LOCUS_07100 255130 255906 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898387.1 protein_id gnl|my_center|LOCUS_07100 256117 257361 gene locus_tag LOCUS_07110 256117 257361 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112798.1 protein_id gnl|my_center|LOCUS_07110 257821 257432 gene locus_tag LOCUS_07120 257821 257432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 259346 258000 gene locus_tag LOCUS_07130 259346 258000 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080841.1 protein_id gnl|my_center|LOCUS_07130 260204 259542 gene locus_tag LOCUS_07140 260204 259542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 262000 260285 gene locus_tag LOCUS_07150 262000 260285 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_07150 262542 262021 gene locus_tag LOCUS_07160 262542 262021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 262895 263080 gene locus_tag LOCUS_07170 262895 263080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 262998 265043 gene locus_tag LOCUS_07180 262998 265043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 265712 267415 gene locus_tag LOCUS_07190 265712 267415 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337967.1 protein_id gnl|my_center|LOCUS_07190 267512 269536 gene locus_tag LOCUS_07200 267512 269536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 269555 270058 gene locus_tag LOCUS_07210 269555 270058 CDS product cytidine diphosphoramidate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858462.1 protein_id gnl|my_center|LOCUS_07210 270070 270780 gene locus_tag LOCUS_07220 270070 270780 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002380521.1 protein_id gnl|my_center|LOCUS_07220 270859 271827 gene locus_tag LOCUS_07230 270859 271827 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383751.1 protein_id gnl|my_center|LOCUS_07230 271828 272640 gene locus_tag LOCUS_07240 271828 272640 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937958.1 protein_id gnl|my_center|LOCUS_07240 272841 272662 gene locus_tag LOCUS_07250 272841 272662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 272810 273931 gene locus_tag LOCUS_07260 gene vioA 272810 273931 CDS product dTDP-4-amino-4,6-dideoxy-D-glucose aminotransferase VioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244389.1 protein_id gnl|my_center|LOCUS_07260 273928 274812 gene locus_tag LOCUS_07270 gene rfbA 273928 274812 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389370.1 protein_id gnl|my_center|LOCUS_07270 274865 275884 gene locus_tag LOCUS_07280 gene rfbB 274865 275884 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_07280 275917 276978 gene locus_tag LOCUS_07290 275917 276978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 276995 277939 gene locus_tag LOCUS_07300 276995 277939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 278031 279350 gene locus_tag LOCUS_07310 278031 279350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 279347 279844 gene locus_tag LOCUS_07320 279347 279844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 279894 280127 gene locus_tag LOCUS_07330 279894 280127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 280147 281256 gene locus_tag LOCUS_07340 280147 281256 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066524.1 protein_id gnl|my_center|LOCUS_07340 281273 281929 gene locus_tag LOCUS_07350 281273 281929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 281926 282660 gene locus_tag LOCUS_07360 gene fabG 281926 282660 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_07360 282657 283490 gene locus_tag LOCUS_07370 282657 283490 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_07370 283487 284464 gene locus_tag LOCUS_07380 283487 284464 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545386.1 protein_id gnl|my_center|LOCUS_07380 284461 285540 gene locus_tag LOCUS_07390 284461 285540 CDS product acyl-protein synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707830.1 protein_id gnl|my_center|LOCUS_07390 285521 286702 gene locus_tag LOCUS_07400 285521 286702 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222164.1 protein_id gnl|my_center|LOCUS_07400 286689 287456 gene locus_tag LOCUS_07410 gene fabG 286689 287456 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681771.1 protein_id gnl|my_center|LOCUS_07410 287486 289297 gene locus_tag LOCUS_07420 287486 289297 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879216.1 protein_id gnl|my_center|LOCUS_07420 289327 289566 gene locus_tag LOCUS_07430 289327 289566 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707833.1 protein_id gnl|my_center|LOCUS_07430 289587 290420 gene locus_tag LOCUS_07440 289587 290420 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556591.1 protein_id gnl|my_center|LOCUS_07440 290454 291866 gene locus_tag LOCUS_07450 290454 291866 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222162.1 protein_id gnl|my_center|LOCUS_07450 292005 292721 gene locus_tag LOCUS_07460 gene mubT 292005 292721 CDS product mutanobactin A biosynthesis thioesterase MubT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310357.1 protein_id gnl|my_center|LOCUS_07460 292711 293799 gene locus_tag LOCUS_07470 292711 293799 CDS product acyl-protein synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707830.1 protein_id gnl|my_center|LOCUS_07470 293780 295000 gene locus_tag LOCUS_07480 293780 295000 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707829.1 protein_id gnl|my_center|LOCUS_07480 295100 296245 gene locus_tag LOCUS_07490 295100 296245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 296305 297279 gene locus_tag LOCUS_07500 296305 297279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 297300 298292 gene locus_tag LOCUS_07510 gene pseB 297300 298292 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015759.1 protein_id gnl|my_center|LOCUS_07510 298363 299391 gene locus_tag LOCUS_07520 298363 299391 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432947.1 protein_id gnl|my_center|LOCUS_07520 299465 300364 gene locus_tag LOCUS_07530 299465 300364 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015758.1 protein_id gnl|my_center|LOCUS_07530 300586 301290 gene locus_tag LOCUS_07540 300586 301290 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_07540 301308 302621 gene locus_tag LOCUS_07550 301308 302621 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869430.1 protein_id gnl|my_center|LOCUS_07550 302643 303836 gene locus_tag LOCUS_07560 gene pseC 302643 303836 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867760.1 protein_id gnl|my_center|LOCUS_07560 303850 304881 gene locus_tag LOCUS_07570 gene pseI 303850 304881 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987011.1 protein_id gnl|my_center|LOCUS_07570 304891 305415 gene locus_tag LOCUS_07580 304891 305415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 305605 305901 gene locus_tag LOCUS_07590 305605 305901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 305904 306920 gene locus_tag LOCUS_07600 gene pseG 305904 306920 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965485.1 protein_id gnl|my_center|LOCUS_07600 307007 308746 gene locus_tag LOCUS_07610 307007 308746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 308755 309534 gene locus_tag LOCUS_07620 gene rfbF 308755 309534 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816687.1 protein_id gnl|my_center|LOCUS_07620 309525 309710 gene locus_tag LOCUS_07630 309525 309710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 309826 310659 gene locus_tag LOCUS_07640 309826 310659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 310707 311294 gene locus_tag LOCUS_07650 gene rfbC 310707 311294 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877392.1 protein_id gnl|my_center|LOCUS_07650 311323 312663 gene locus_tag LOCUS_07660 gene rfbH 311323 312663 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126347.1 protein_id gnl|my_center|LOCUS_07660 312685 313587 gene locus_tag LOCUS_07670 312685 313587 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987005.1 protein_id gnl|my_center|LOCUS_07670 313592 315298 gene locus_tag LOCUS_07680 gene ilvB 313592 315298 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_07680 315303 316382 gene locus_tag LOCUS_07690 gene rfbG 315303 316382 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967024.1 protein_id gnl|my_center|LOCUS_07690 316397 317335 gene locus_tag LOCUS_07700 gene rfbB 316397 317335 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_07700 >Feature sequence003 298 858 gene locus_tag LOCUS_07710 298 858 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_07710 966 2147 gene locus_tag LOCUS_07720 966 2147 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948034.1 protein_id gnl|my_center|LOCUS_07720 2679 2185 gene locus_tag LOCUS_07730 2679 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 2889 4997 gene locus_tag LOCUS_07740 gene glgX 2889 4997 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122228.1 protein_id gnl|my_center|LOCUS_07740 5808 5068 gene locus_tag LOCUS_07750 5808 5068 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965675.1 protein_id gnl|my_center|LOCUS_07750 7135 5969 gene locus_tag LOCUS_07760 7135 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 7318 8343 gene locus_tag LOCUS_07770 7318 8343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 8362 9366 gene locus_tag LOCUS_07780 8362 9366 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096773.1 protein_id gnl|my_center|LOCUS_07780 9363 10547 gene locus_tag LOCUS_07790 9363 10547 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062220.1 protein_id gnl|my_center|LOCUS_07790 10579 11238 gene locus_tag LOCUS_07800 10579 11238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 11328 12608 gene locus_tag LOCUS_07810 11328 12608 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392338.1 protein_id gnl|my_center|LOCUS_07810 12663 14069 gene locus_tag LOCUS_07820 12663 14069 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537911.1 protein_id gnl|my_center|LOCUS_07820 14186 14968 gene locus_tag LOCUS_07830 14186 14968 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048188.1 protein_id gnl|my_center|LOCUS_07830 14989 16191 gene locus_tag LOCUS_07840 14989 16191 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986697.1 protein_id gnl|my_center|LOCUS_07840 16219 17517 gene locus_tag LOCUS_07850 gene hadB 16219 17517 CDS product (R)-2-hydroxyisocaproyl-CoA dehydratase subunit HadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888224.1 protein_id gnl|my_center|LOCUS_07850 17510 18637 gene locus_tag LOCUS_07860 17510 18637 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986695.1 protein_id gnl|my_center|LOCUS_07860 18668 19864 gene locus_tag LOCUS_07870 18668 19864 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_07870 19902 20780 gene locus_tag LOCUS_07880 19902 20780 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460375.1 protein_id gnl|my_center|LOCUS_07880 21015 22850 gene locus_tag LOCUS_07890 21015 22850 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679271.1 protein_id gnl|my_center|LOCUS_07890 22844 24586 gene locus_tag LOCUS_07900 22844 24586 CDS product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671107.1 protein_id gnl|my_center|LOCUS_07900 25078 25446 gene locus_tag LOCUS_07910 25078 25446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 29682 26071 gene locus_tag LOCUS_07920 29682 26071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 31312 29696 gene locus_tag LOCUS_07930 31312 29696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 32018 31305 gene locus_tag LOCUS_07940 32018 31305 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966072.1 protein_id gnl|my_center|LOCUS_07940 32155 33156 gene locus_tag LOCUS_07950 32155 33156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 33189 33821 gene locus_tag LOCUS_07960 33189 33821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 33967 35118 gene locus_tag LOCUS_07970 33967 35118 CDS product reverse transcriptase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046082755.1 protein_id gnl|my_center|LOCUS_07970 35282 35608 gene locus_tag LOCUS_07980 35282 35608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 35890 36102 gene locus_tag LOCUS_07990 35890 36102 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885335.1 protein_id gnl|my_center|LOCUS_07990 36121 36486 gene locus_tag LOCUS_08000 36121 36486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 37904 36537 gene locus_tag LOCUS_08010 37904 36537 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399787.1 protein_id gnl|my_center|LOCUS_08010 38609 37908 gene locus_tag LOCUS_08020 38609 37908 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012994104.1 protein_id gnl|my_center|LOCUS_08020 38754 39518 gene locus_tag LOCUS_08030 38754 39518 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138603.1 protein_id gnl|my_center|LOCUS_08030 39515 40240 gene locus_tag LOCUS_08040 39515 40240 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994320.1 protein_id gnl|my_center|LOCUS_08040 40253 41017 gene locus_tag LOCUS_08050 40253 41017 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114222.1 protein_id gnl|my_center|LOCUS_08050 41022 41321 gene locus_tag LOCUS_08060 41022 41321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 41332 41688 gene locus_tag LOCUS_08070 41332 41688 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687513.1 protein_id gnl|my_center|LOCUS_08070 42123 42326 gene locus_tag LOCUS_08080 42123 42326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 42592 44220 gene locus_tag LOCUS_08090 42592 44220 CDS product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861112.1 protein_id gnl|my_center|LOCUS_08090 44233 44484 gene locus_tag LOCUS_08100 44233 44484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 44481 45128 gene locus_tag LOCUS_08110 44481 45128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 45125 45481 gene locus_tag LOCUS_08120 45125 45481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 45620 45949 gene locus_tag LOCUS_08130 45620 45949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 45951 46298 gene locus_tag LOCUS_08140 gene mobC 45951 46298 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368707.1 protein_id gnl|my_center|LOCUS_08140 47783 46443 gene locus_tag LOCUS_08150 47783 46443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 47810 49297 gene locus_tag LOCUS_08160 47810 49297 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368703.1 protein_id gnl|my_center|LOCUS_08160 49580 50191 gene locus_tag LOCUS_08170 49580 50191 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860862.1 protein_id gnl|my_center|LOCUS_08170 50188 52755 gene locus_tag LOCUS_08180 50188 52755 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860863.1 protein_id gnl|my_center|LOCUS_08180 52748 53917 gene locus_tag LOCUS_08190 gene blt 52748 53917 CDS product multidrug efflux MFS transporter Blt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229880.1 protein_id gnl|my_center|LOCUS_08190 54738 55157 gene locus_tag LOCUS_08200 54738 55157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 55394 55627 gene locus_tag LOCUS_08210 55394 55627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 55780 55968 gene locus_tag LOCUS_08220 55780 55968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 56055 56243 gene locus_tag LOCUS_08230 56055 56243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 56281 57066 gene locus_tag LOCUS_08240 56281 57066 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227804.1 protein_id gnl|my_center|LOCUS_08240 57063 57974 gene locus_tag LOCUS_08250 57063 57974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 57991 58338 gene locus_tag LOCUS_08260 57991 58338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 58506 59531 gene locus_tag LOCUS_08270 58506 59531 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368732.1 protein_id gnl|my_center|LOCUS_08270 59562 59903 gene locus_tag LOCUS_08280 59562 59903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 59989 65817 gene locus_tag LOCUS_08290 59989 65817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 65835 72527 gene locus_tag LOCUS_08300 65835 72527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 72599 73402 gene locus_tag LOCUS_08310 72599 73402 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004056545.1 protein_id gnl|my_center|LOCUS_08310 73347 73949 gene locus_tag LOCUS_08320 73347 73949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 73979 74458 gene locus_tag LOCUS_08330 73979 74458 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368727.1 protein_id gnl|my_center|LOCUS_08330 74455 76227 gene locus_tag LOCUS_08340 74455 76227 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368726.1 protein_id gnl|my_center|LOCUS_08340 76658 76185 gene locus_tag LOCUS_08350 76658 76185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809638.1 protein_id gnl|my_center|LOCUS_08350 76901 77065 gene locus_tag LOCUS_08360 76901 77065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 77223 77435 gene locus_tag LOCUS_08370 77223 77435 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885335.1 protein_id gnl|my_center|LOCUS_08370 77454 77819 gene locus_tag LOCUS_08380 77454 77819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 77958 80333 gene locus_tag LOCUS_08390 77958 80333 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178939948.1 protein_id gnl|my_center|LOCUS_08390 80349 81107 gene locus_tag LOCUS_08400 80349 81107 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721684.1 protein_id gnl|my_center|LOCUS_08400 81109 81774 gene locus_tag LOCUS_08410 81109 81774 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 protein_id gnl|my_center|LOCUS_08410 81761 82984 gene locus_tag LOCUS_08420 81761 82984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 83411 83205 gene locus_tag LOCUS_08430 83411 83205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 83526 83924 gene locus_tag LOCUS_08440 83526 83924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 84034 84492 gene locus_tag LOCUS_08450 84034 84492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 84499 84777 gene locus_tag LOCUS_08460 84499 84777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 85174 84941 gene locus_tag LOCUS_08470 85174 84941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 85094 86419 gene locus_tag LOCUS_08480 85094 86419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 86451 86771 gene locus_tag LOCUS_08490 86451 86771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 86784 87746 gene locus_tag LOCUS_08500 86784 87746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 87736 88077 gene locus_tag LOCUS_08510 87736 88077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 88074 88448 gene locus_tag LOCUS_08520 88074 88448 CDS product cysteine-rich VLP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861105.1 protein_id gnl|my_center|LOCUS_08520 88562 89317 gene locus_tag LOCUS_08530 88562 89317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 89314 90120 gene locus_tag LOCUS_08540 89314 90120 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860782.1 protein_id gnl|my_center|LOCUS_08540 90147 90356 gene locus_tag LOCUS_08550 90147 90356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 90346 92001 gene locus_tag LOCUS_08560 90346 92001 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_08560 92192 93061 gene locus_tag LOCUS_08570 92192 93061 CDS product CD0415/CD1112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368724.1 protein_id gnl|my_center|LOCUS_08570 93083 93508 gene locus_tag LOCUS_08580 93083 93508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 93510 93950 gene locus_tag LOCUS_08590 93510 93950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 93966 94775 gene locus_tag LOCUS_08600 93966 94775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 95434 94790 gene locus_tag LOCUS_08610 95434 94790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 95666 96085 gene locus_tag LOCUS_08620 95666 96085 CDS product PrgI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368721.1 protein_id gnl|my_center|LOCUS_08620 96018 98492 gene locus_tag LOCUS_08630 96018 98492 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_08630 98517 99314 gene locus_tag LOCUS_08640 98517 99314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 99311 102418 gene locus_tag LOCUS_08650 99311 102418 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773625.1 protein_id gnl|my_center|LOCUS_08650 102450 103358 gene locus_tag LOCUS_08660 102450 103358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040412236.1 protein_id gnl|my_center|LOCUS_08660 103351 103596 gene locus_tag LOCUS_08670 103351 103596 CDS product DUF4315 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368716.1 protein_id gnl|my_center|LOCUS_08670 103601 105049 gene locus_tag LOCUS_08680 103601 105049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 105046 105246 gene locus_tag LOCUS_08690 105046 105246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190240604.1 protein_id gnl|my_center|LOCUS_08690 105218 107338 gene locus_tag LOCUS_08700 105218 107338 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368714.1 protein_id gnl|my_center|LOCUS_08700 107335 107748 gene locus_tag LOCUS_08710 107335 107748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 107753 108163 gene locus_tag LOCUS_08720 107753 108163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 108168 108461 gene locus_tag LOCUS_08730 108168 108461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 108533 108763 gene locus_tag LOCUS_08740 108533 108763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 109726 108935 gene locus_tag LOCUS_08750 109726 108935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 109725 110090 gene locus_tag LOCUS_08760 109725 110090 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_08760 110353 110081 gene locus_tag LOCUS_08770 110353 110081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 110288 119632 gene locus_tag LOCUS_08780 110288 119632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 119629 119967 gene locus_tag LOCUS_08790 gene mobC 119629 119967 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368707.1 protein_id gnl|my_center|LOCUS_08790 119954 120982 gene locus_tag LOCUS_08800 119954 120982 CDS product DUF3991 and toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368706.1 protein_id gnl|my_center|LOCUS_08800 121325 120984 gene locus_tag LOCUS_08810 121325 120984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 121514 122890 gene locus_tag LOCUS_08820 121514 122890 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368703.1 protein_id gnl|my_center|LOCUS_08820 123309 122962 gene locus_tag LOCUS_08830 123309 122962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 123860 123555 gene locus_tag LOCUS_08840 123860 123555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 124317 124009 gene locus_tag LOCUS_08850 124317 124009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 124515 125330 gene locus_tag LOCUS_08860 124515 125330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 125379 125513 gene locus_tag LOCUS_08870 125379 125513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 127170 125524 gene locus_tag LOCUS_08880 127170 125524 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680024.1 protein_id gnl|my_center|LOCUS_08880 128251 128009 gene locus_tag LOCUS_08890 128251 128009 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009009556.1 protein_id gnl|my_center|LOCUS_08890 128676 128248 gene locus_tag LOCUS_08900 128676 128248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 129988 128861 gene locus_tag LOCUS_08910 129988 128861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 130137 129985 gene locus_tag LOCUS_08920 130137 129985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 130988 130452 gene locus_tag LOCUS_08930 130988 130452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 132034 130985 gene locus_tag LOCUS_08940 gene vanG 132034 130985 CDS product D-alanine--D-serine ligase VanG-Cd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861276.1 protein_id gnl|my_center|LOCUS_08940 133307 132165 gene locus_tag LOCUS_08950 133307 132165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 134004 133297 gene locus_tag LOCUS_08960 gene vanR 134004 133297 CDS product vancomycin resistance response regulator transcription factor VanR-I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461303.1 protein_id gnl|my_center|LOCUS_08960 134793 134485 gene locus_tag LOCUS_08970 134793 134485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 135912 136832 gene locus_tag LOCUS_08980 135912 136832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 136886 137764 gene locus_tag LOCUS_08990 136886 137764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 137804 138352 gene locus_tag LOCUS_09000 137804 138352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 138377 138790 gene locus_tag LOCUS_09010 138377 138790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 138988 140367 gene locus_tag LOCUS_09020 138988 140367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 140572 140354 gene locus_tag LOCUS_09030 140572 140354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 140800 141174 gene locus_tag LOCUS_09040 140800 141174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 141349 141765 gene locus_tag LOCUS_09050 141349 141765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09050 141811 144654 gene locus_tag LOCUS_09060 141811 144654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 144919 145227 gene locus_tag LOCUS_09070 144919 145227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 145530 145901 gene locus_tag LOCUS_09080 145530 145901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 146239 146421 gene locus_tag LOCUS_09090 146239 146421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 146516 146833 gene locus_tag LOCUS_09100 146516 146833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 147428 148405 gene locus_tag LOCUS_09110 147428 148405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 148402 149262 gene locus_tag LOCUS_09120 148402 149262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368666.1 protein_id gnl|my_center|LOCUS_09120 149331 149597 gene locus_tag LOCUS_09130 149331 149597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 149731 151371 gene locus_tag LOCUS_09140 149731 151371 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_09140 151373 153076 gene locus_tag LOCUS_09150 151373 153076 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_09150 153073 154683 gene locus_tag LOCUS_09160 153073 154683 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_09160 154673 155056 gene locus_tag LOCUS_09170 154673 155056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 155133 155453 gene locus_tag LOCUS_09180 155133 155453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 155523 156908 gene locus_tag LOCUS_09190 155523 156908 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047851.1 protein_id gnl|my_center|LOCUS_09190 157279 157461 gene locus_tag LOCUS_09200 157279 157461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 157558 158052 gene locus_tag LOCUS_09210 157558 158052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09210 158229 158480 gene locus_tag LOCUS_09220 158229 158480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 158597 159136 gene locus_tag LOCUS_09230 158597 159136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 159133 159951 gene locus_tag LOCUS_09240 159133 159951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 159969 160586 gene locus_tag LOCUS_09250 159969 160586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 160564 160716 gene locus_tag LOCUS_09260 160564 160716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 160720 161568 gene locus_tag LOCUS_09270 160720 161568 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861239.1 protein_id gnl|my_center|LOCUS_09270 161661 161855 gene locus_tag LOCUS_09280 161661 161855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 161830 163596 gene locus_tag LOCUS_09290 161830 163596 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861938.1 protein_id gnl|my_center|LOCUS_09290 163711 163571 gene locus_tag LOCUS_09300 163711 163571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 164110 163778 gene locus_tag LOCUS_09310 164110 163778 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355924.1 protein_id gnl|my_center|LOCUS_09310 164706 164107 gene locus_tag LOCUS_09320 164706 164107 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764887.1 protein_id gnl|my_center|LOCUS_09320 165190 164810 gene locus_tag LOCUS_09330 165190 164810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 165525 166349 gene locus_tag LOCUS_09340 165525 166349 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648604.1 protein_id gnl|my_center|LOCUS_09340 166342 166569 gene locus_tag LOCUS_09350 166342 166569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 167809 166961 gene locus_tag LOCUS_09360 167809 166961 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902960.1 protein_id gnl|my_center|LOCUS_09360 168474 167953 gene locus_tag LOCUS_09370 168474 167953 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774219.1 protein_id gnl|my_center|LOCUS_09370 168594 169931 gene locus_tag LOCUS_09380 168594 169931 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861931.1 protein_id gnl|my_center|LOCUS_09380 170375 170175 gene locus_tag LOCUS_09390 170375 170175 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423163.1 protein_id gnl|my_center|LOCUS_09390 171047 170379 gene locus_tag LOCUS_09400 171047 170379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 171435 171118 gene locus_tag LOCUS_09410 171435 171118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 171319 172038 gene locus_tag LOCUS_09420 171319 172038 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948727.1 protein_id gnl|my_center|LOCUS_09420 172035 173342 gene locus_tag LOCUS_09430 172035 173342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 173335 173541 gene locus_tag LOCUS_09440 173335 173541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435950.1 protein_id gnl|my_center|LOCUS_09440 173602 173811 gene locus_tag LOCUS_09450 173602 173811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 174050 174697 gene locus_tag LOCUS_09460 174050 174697 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227564.1 protein_id gnl|my_center|LOCUS_09460 175120 175347 gene locus_tag LOCUS_09470 175120 175347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 175715 175999 gene locus_tag LOCUS_09480 175715 175999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 176044 176829 gene locus_tag LOCUS_09490 176044 176829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 177383 176862 gene locus_tag LOCUS_09500 177383 176862 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_09500 177870 177409 gene locus_tag LOCUS_09510 gene smpB 177870 177409 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545050.1 protein_id gnl|my_center|LOCUS_09510 180397 178055 gene locus_tag LOCUS_09520 180397 178055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 181067 180372 gene locus_tag LOCUS_09530 181067 180372 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454617.1 protein_id gnl|my_center|LOCUS_09530 181773 181252 gene locus_tag LOCUS_09540 181773 181252 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946311.1 protein_id gnl|my_center|LOCUS_09540 182477 181899 gene locus_tag LOCUS_09550 182477 181899 CDS product spore maturation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356382.1 protein_id gnl|my_center|LOCUS_09550 182730 182981 gene locus_tag LOCUS_09560 182730 182981 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388120.1 protein_id gnl|my_center|LOCUS_09560 183671 183042 gene locus_tag LOCUS_09570 183671 183042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 184060 186570 gene locus_tag LOCUS_09580 gene pcrA 184060 186570 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163769.1 protein_id gnl|my_center|LOCUS_09580 187324 189015 gene locus_tag LOCUS_09590 187324 189015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 189024 189719 gene locus_tag LOCUS_09600 189024 189719 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045103290.1 protein_id gnl|my_center|LOCUS_09600 189716 191011 gene locus_tag LOCUS_09610 189716 191011 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054370.1 protein_id gnl|my_center|LOCUS_09610 191128 193470 gene locus_tag LOCUS_09620 191128 193470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 193736 193518 gene locus_tag LOCUS_09630 193736 193518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 194147 193977 gene locus_tag LOCUS_09640 194147 193977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 195664 194213 gene locus_tag LOCUS_09650 gene nhaC 195664 194213 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426252.1 protein_id gnl|my_center|LOCUS_09650 197393 196167 gene locus_tag LOCUS_09660 197393 196167 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_09660 198335 197454 gene locus_tag LOCUS_09670 gene argB 198335 197454 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940826.1 protein_id gnl|my_center|LOCUS_09670 199574 198351 gene locus_tag LOCUS_09680 gene argJ 199574 198351 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_09680 200769 199696 gene locus_tag LOCUS_09690 gene argC 200769 199696 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_09690 201033 201950 gene locus_tag LOCUS_09700 201033 201950 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642437.1 protein_id gnl|my_center|LOCUS_09700 202122 202415 gene locus_tag LOCUS_09710 202122 202415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 202905 203180 gene locus_tag LOCUS_09720 202905 203180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 203240 203710 gene locus_tag LOCUS_09730 203240 203710 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021451.1 protein_id gnl|my_center|LOCUS_09730 203712 204284 gene locus_tag LOCUS_09740 203712 204284 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107442.1 protein_id gnl|my_center|LOCUS_09740 204420 204923 gene locus_tag LOCUS_09750 204420 204923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 205322 206476 gene locus_tag LOCUS_09760 205322 206476 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461367.1 protein_id gnl|my_center|LOCUS_09760 206593 207141 gene locus_tag LOCUS_09770 gene raiA 206593 207141 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289771.1 protein_id gnl|my_center|LOCUS_09770 207367 208359 gene locus_tag LOCUS_09780 207367 208359 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768282.1 protein_id gnl|my_center|LOCUS_09780 208947 208393 gene locus_tag LOCUS_09790 208947 208393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 209874 208948 gene locus_tag LOCUS_09800 209874 208948 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102581.1 protein_id gnl|my_center|LOCUS_09800 210792 209938 gene locus_tag LOCUS_09810 210792 209938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 211244 211657 gene locus_tag LOCUS_09820 211244 211657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 212017 213768 gene locus_tag LOCUS_09830 212017 213768 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262192.1 protein_id gnl|my_center|LOCUS_09830 215276 213894 gene locus_tag LOCUS_09840 215276 213894 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_09840 215665 216930 gene locus_tag LOCUS_09850 215665 216930 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460409.1 protein_id gnl|my_center|LOCUS_09850 217112 217915 gene locus_tag LOCUS_09860 217112 217915 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966616.1 protein_id gnl|my_center|LOCUS_09860 218658 218455 gene locus_tag LOCUS_09870 218658 218455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 219088 218630 gene locus_tag LOCUS_09880 219088 218630 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905239.1 protein_id gnl|my_center|LOCUS_09880 220629 219436 gene locus_tag LOCUS_09890 220629 219436 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610375.1 protein_id gnl|my_center|LOCUS_09890 220921 220718 gene locus_tag LOCUS_09900 220921 220718 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004613735.1 protein_id gnl|my_center|LOCUS_09900 221667 221428 gene locus_tag LOCUS_09910 221667 221428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 222088 221654 gene locus_tag LOCUS_09920 222088 221654 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898598.1 protein_id gnl|my_center|LOCUS_09920 224316 222631 gene locus_tag LOCUS_09930 224316 222631 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948347.1 protein_id gnl|my_center|LOCUS_09930 224570 224331 gene locus_tag LOCUS_09940 224570 224331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 225327 224680 gene locus_tag LOCUS_09950 225327 224680 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056290.1 protein_id gnl|my_center|LOCUS_09950 226233 225763 gene locus_tag LOCUS_09960 226233 225763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 226523 226254 gene locus_tag LOCUS_09970 226523 226254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 227370 226546 gene locus_tag LOCUS_09980 227370 226546 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454242.1 protein_id gnl|my_center|LOCUS_09980 228154 227381 gene locus_tag LOCUS_09990 228154 227381 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861094.1 protein_id gnl|my_center|LOCUS_09990 229070 228147 gene locus_tag LOCUS_10000 229070 228147 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861095.1 protein_id gnl|my_center|LOCUS_10000 230133 229210 gene locus_tag LOCUS_10010 230133 229210 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861096.1 protein_id gnl|my_center|LOCUS_10010 230829 230137 gene locus_tag LOCUS_10020 230829 230137 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861097.1 protein_id gnl|my_center|LOCUS_10020 231019 230822 gene locus_tag LOCUS_10030 231019 230822 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434206.1 protein_id gnl|my_center|LOCUS_10030 231181 231537 gene locus_tag LOCUS_10040 231181 231537 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861099.1 protein_id gnl|my_center|LOCUS_10040 231782 232111 gene locus_tag LOCUS_10050 gene mobC 231782 232111 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861100.1 protein_id gnl|my_center|LOCUS_10050 235339 232418 gene locus_tag LOCUS_10060 235339 232418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 235848 235324 gene locus_tag LOCUS_10070 235848 235324 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861118.1 protein_id gnl|my_center|LOCUS_10070 236117 235890 gene locus_tag LOCUS_10080 236117 235890 CDS product DUF5348 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610290.1 protein_id gnl|my_center|LOCUS_10080 237138 236149 gene locus_tag LOCUS_10090 237138 236149 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861119.1 protein_id gnl|my_center|LOCUS_10090 237362 237198 gene locus_tag LOCUS_10100 237362 237198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 238264 238623 gene locus_tag LOCUS_10110 238264 238623 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888340.1 protein_id gnl|my_center|LOCUS_10110 238649 238798 gene locus_tag LOCUS_10120 238649 238798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 239499 240029 gene locus_tag LOCUS_10130 239499 240029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 240487 241113 gene locus_tag LOCUS_10140 240487 241113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 241110 241319 gene locus_tag LOCUS_10150 241110 241319 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721916.1 protein_id gnl|my_center|LOCUS_10150 241426 241917 gene locus_tag LOCUS_10160 241426 241917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 242162 243538 gene locus_tag LOCUS_10170 242162 243538 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272719.1 protein_id gnl|my_center|LOCUS_10170 243848 244831 gene locus_tag LOCUS_10180 243848 244831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 >Feature sequence004 489 58 gene locus_tag LOCUS_10190 489 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 928 506 gene locus_tag LOCUS_10200 928 506 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965892.1 protein_id gnl|my_center|LOCUS_10200 1335 925 gene locus_tag LOCUS_10210 1335 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 1980 1357 gene locus_tag LOCUS_10220 1980 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 2254 1994 gene locus_tag LOCUS_10230 2254 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 3726 2242 gene locus_tag LOCUS_10240 3726 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 4897 4256 gene locus_tag LOCUS_10250 4897 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 7151 5112 gene locus_tag LOCUS_10260 7151 5112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 7565 7164 gene locus_tag LOCUS_10270 7565 7164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 8042 7590 gene locus_tag LOCUS_10280 8042 7590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 9246 8107 gene locus_tag LOCUS_10290 9246 8107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 9585 9268 gene locus_tag LOCUS_10300 9585 9268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 9798 9607 gene locus_tag LOCUS_10310 9798 9607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 10109 9813 gene locus_tag LOCUS_10320 10109 9813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 11074 10145 gene locus_tag LOCUS_10330 11074 10145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 11525 11103 gene locus_tag LOCUS_10340 11525 11103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 11936 11568 gene locus_tag LOCUS_10350 11936 11568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 12755 11940 gene locus_tag LOCUS_10360 12755 11940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 12956 12777 gene locus_tag LOCUS_10370 12956 12777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 16850 12957 gene locus_tag LOCUS_10380 16850 12957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 23375 16911 gene locus_tag LOCUS_10390 23375 16911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 23445 23957 gene locus_tag LOCUS_10400 23445 23957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 27465 24388 gene locus_tag LOCUS_10410 27465 24388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 27988 27521 gene locus_tag LOCUS_10420 27988 27521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 28620 28003 gene locus_tag LOCUS_10430 28620 28003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 29071 28622 gene locus_tag LOCUS_10440 29071 28622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 29390 29124 gene locus_tag LOCUS_10450 29390 29124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 29738 29406 gene locus_tag LOCUS_10460 29738 29406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 30619 29783 gene locus_tag LOCUS_10470 30619 29783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 31392 30664 gene locus_tag LOCUS_10480 31392 30664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 31883 31389 gene locus_tag LOCUS_10490 31883 31389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 32610 31894 gene locus_tag LOCUS_10500 32610 31894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 33094 32675 gene locus_tag LOCUS_10510 33094 32675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 33622 33110 gene locus_tag LOCUS_10520 33622 33110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 34727 33657 gene locus_tag LOCUS_10530 34727 33657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 35334 34756 gene locus_tag LOCUS_10540 35334 34756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 36809 35358 gene locus_tag LOCUS_10550 36809 35358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 38391 36853 gene locus_tag LOCUS_10560 38391 36853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 40055 38409 gene locus_tag LOCUS_10570 40055 38409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 41114 40056 gene locus_tag LOCUS_10580 41114 40056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 41215 41140 gene locus_tag LOCUS_t00110 41215 41140 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 41429 41355 gene locus_tag LOCUS_t00120 41429 41355 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 41732 41647 gene locus_tag LOCUS_t00130 41732 41647 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 41974 41744 gene locus_tag LOCUS_10590 41974 41744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 42069 41996 gene locus_tag LOCUS_t00140 42069 41996 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 42220 42145 gene locus_tag LOCUS_t00150 42220 42145 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 42485 42399 gene locus_tag LOCUS_t00160 42485 42399 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 43082 42507 gene locus_tag LOCUS_10600 43082 42507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 43183 43108 gene locus_tag LOCUS_t00170 43183 43108 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 43262 43187 gene locus_tag LOCUS_t00180 43262 43187 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 43340 43265 gene locus_tag LOCUS_t00190 43340 43265 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 43422 43346 gene locus_tag LOCUS_t00200 43422 43346 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 43507 43433 gene locus_tag LOCUS_t00210 43507 43433 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 43587 43509 gene locus_tag LOCUS_t00220 43587 43509 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 43931 43671 gene locus_tag LOCUS_10610 43931 43671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 44421 43912 gene locus_tag LOCUS_10620 44421 43912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 44687 44613 gene locus_tag LOCUS_t00230 44687 44613 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 44885 44811 gene locus_tag LOCUS_t00240 44885 44811 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 45192 44920 gene locus_tag LOCUS_10630 45192 44920 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003015647.1 protein_id gnl|my_center|LOCUS_10630 46388 45201 gene locus_tag LOCUS_10640 46388 45201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399278.1 protein_id gnl|my_center|LOCUS_10640 46608 46426 gene locus_tag LOCUS_10650 46608 46426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 47470 46643 gene locus_tag LOCUS_10660 47470 46643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 48122 47484 gene locus_tag LOCUS_10670 48122 47484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 48357 48136 gene locus_tag LOCUS_10680 48357 48136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 51448 48485 gene locus_tag LOCUS_10690 51448 48485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964453.1 protein_id gnl|my_center|LOCUS_10690 51824 51462 gene locus_tag LOCUS_10700 51824 51462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 52302 51859 gene locus_tag LOCUS_10710 52302 51859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 52777 52286 gene locus_tag LOCUS_10720 52777 52286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 53202 52792 gene locus_tag LOCUS_10730 53202 52792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 53780 53211 gene locus_tag LOCUS_10740 53780 53211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 54925 53780 gene locus_tag LOCUS_10750 gene nifS 54925 53780 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583089.1 protein_id gnl|my_center|LOCUS_10750 55136 54930 gene locus_tag LOCUS_10760 55136 54930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 57001 55196 gene locus_tag LOCUS_10770 gene pcrA 57001 55196 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457083.1 protein_id gnl|my_center|LOCUS_10770 57269 56991 gene locus_tag LOCUS_10780 57269 56991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 58248 57256 gene locus_tag LOCUS_10790 58248 57256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 59456 58692 gene locus_tag LOCUS_10800 59456 58692 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231473.1 protein_id gnl|my_center|LOCUS_10800 60801 61130 gene locus_tag LOCUS_10810 60801 61130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 61409 61795 gene locus_tag LOCUS_10820 61409 61795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 61795 62025 gene locus_tag LOCUS_10830 61795 62025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 62087 62419 gene locus_tag LOCUS_10840 62087 62419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 62512 62904 gene locus_tag LOCUS_10850 62512 62904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 62985 63167 gene locus_tag LOCUS_10860 62985 63167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 63180 63422 gene locus_tag LOCUS_10870 63180 63422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 63412 63648 gene locus_tag LOCUS_10880 63412 63648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 63665 63916 gene locus_tag LOCUS_10890 63665 63916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 63942 64109 gene locus_tag LOCUS_10900 63942 64109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 64096 64359 gene locus_tag LOCUS_10910 64096 64359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 64359 65066 gene locus_tag LOCUS_10920 64359 65066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 65095 65250 gene locus_tag LOCUS_10930 65095 65250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 65278 65559 gene locus_tag LOCUS_10940 65278 65559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 65971 66411 gene locus_tag LOCUS_10950 65971 66411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 66462 67592 gene locus_tag LOCUS_10960 66462 67592 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964481.1 protein_id gnl|my_center|LOCUS_10960 67646 67993 gene locus_tag LOCUS_10970 67646 67993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 68006 68137 gene locus_tag LOCUS_10980 68006 68137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 68154 68345 gene locus_tag LOCUS_10990 68154 68345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004313635.1 protein_id gnl|my_center|LOCUS_10990 68366 68701 gene locus_tag LOCUS_11000 68366 68701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 68708 69130 gene locus_tag LOCUS_11010 68708 69130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 69127 69330 gene locus_tag LOCUS_11020 69127 69330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 69345 69599 gene locus_tag LOCUS_11030 69345 69599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 69603 69758 gene locus_tag LOCUS_11040 69603 69758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 69778 70116 gene locus_tag LOCUS_11050 69778 70116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 70116 70316 gene locus_tag LOCUS_11060 70116 70316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 70327 70518 gene locus_tag LOCUS_11070 70327 70518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 70520 70663 gene locus_tag LOCUS_11080 70520 70663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 70675 71094 gene locus_tag LOCUS_11090 70675 71094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 71097 71807 gene locus_tag LOCUS_11100 71097 71807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 71812 72201 gene locus_tag LOCUS_11110 71812 72201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 72206 72397 gene locus_tag LOCUS_11120 72206 72397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 72410 72802 gene locus_tag LOCUS_11130 72410 72802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 72815 73381 gene locus_tag LOCUS_11140 72815 73381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 73504 74190 gene locus_tag LOCUS_11150 73504 74190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 74190 74381 gene locus_tag LOCUS_11160 74190 74381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 74386 74709 gene locus_tag LOCUS_11170 74386 74709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 74728 75264 gene locus_tag LOCUS_11180 74728 75264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403167.1 protein_id gnl|my_center|LOCUS_11180 75282 75677 gene locus_tag LOCUS_11190 75282 75677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 75688 75864 gene locus_tag LOCUS_11200 75688 75864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 75836 76162 gene locus_tag LOCUS_11210 75836 76162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 76344 76434 gene locus_tag LOCUS_t00250 76344 76434 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 77075 76533 gene locus_tag LOCUS_11220 77075 76533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 77550 77203 gene locus_tag LOCUS_11230 77550 77203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 77710 78420 gene locus_tag LOCUS_11240 77710 78420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 78502 78756 gene locus_tag LOCUS_11250 78502 78756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11250 78935 79870 gene locus_tag LOCUS_11260 78935 79870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 79933 80011 gene locus_tag LOCUS_t00260 79933 80011 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 80047 80694 gene locus_tag LOCUS_11270 80047 80694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 81338 81625 gene locus_tag LOCUS_11280 81338 81625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 81641 82423 gene locus_tag LOCUS_11290 81641 82423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 82522 84714 gene locus_tag LOCUS_11300 82522 84714 CDS product RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897225.1 protein_id gnl|my_center|LOCUS_11300 84848 85240 gene locus_tag LOCUS_11310 84848 85240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 85241 85978 gene locus_tag LOCUS_11320 85241 85978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 86155 86874 gene locus_tag LOCUS_11330 86155 86874 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086153.1 protein_id gnl|my_center|LOCUS_11330 86871 87398 gene locus_tag LOCUS_11340 86871 87398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310171.1 protein_id gnl|my_center|LOCUS_11340 87408 87563 gene locus_tag LOCUS_11350 87408 87563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 87583 88698 gene locus_tag LOCUS_11360 87583 88698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 88709 88915 gene locus_tag LOCUS_11370 88709 88915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 88927 89328 gene locus_tag LOCUS_11380 88927 89328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 89332 89832 gene locus_tag LOCUS_11390 89332 89832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 89861 90205 gene locus_tag LOCUS_11400 89861 90205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 90241 90546 gene locus_tag LOCUS_11410 90241 90546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 90564 90815 gene locus_tag LOCUS_11420 90564 90815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 90815 91384 gene locus_tag LOCUS_11430 90815 91384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 91400 92548 gene locus_tag LOCUS_11440 91400 92548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 92568 93707 gene locus_tag LOCUS_11450 92568 93707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 93720 94226 gene locus_tag LOCUS_11460 93720 94226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 94232 95707 gene locus_tag LOCUS_11470 94232 95707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 95732 96277 gene locus_tag LOCUS_11480 95732 96277 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080601.1 protein_id gnl|my_center|LOCUS_11480 96289 97008 gene locus_tag LOCUS_11490 96289 97008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 97111 98064 gene locus_tag LOCUS_11500 97111 98064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 98097 99218 gene locus_tag LOCUS_11510 98097 99218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 99234 99611 gene locus_tag LOCUS_11520 99234 99611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 99754 100110 gene locus_tag LOCUS_11530 99754 100110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 100123 100530 gene locus_tag LOCUS_11540 100123 100530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 100543 100746 gene locus_tag LOCUS_11550 100543 100746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 100747 104049 gene locus_tag LOCUS_11560 gene dnaE 100747 104049 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880626.1 protein_id gnl|my_center|LOCUS_11560 104065 104223 gene locus_tag LOCUS_11570 104065 104223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 104236 104436 gene locus_tag LOCUS_11580 104236 104436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 104449 104730 gene locus_tag LOCUS_11590 104449 104730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 104736 105020 gene locus_tag LOCUS_11600 104736 105020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 105010 105345 gene locus_tag LOCUS_11610 105010 105345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 105346 105609 gene locus_tag LOCUS_11620 105346 105609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 105615 105914 gene locus_tag LOCUS_11630 105615 105914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 105922 106134 gene locus_tag LOCUS_11640 105922 106134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 106198 106671 gene locus_tag LOCUS_11650 106198 106671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 106755 108734 gene locus_tag LOCUS_11660 gene ligA 106755 108734 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015784.1 protein_id gnl|my_center|LOCUS_11660 109064 108792 gene locus_tag LOCUS_11670 109064 108792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 109147 109299 gene locus_tag LOCUS_11680 109147 109299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 109409 110266 gene locus_tag LOCUS_11690 109409 110266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 110281 110448 gene locus_tag LOCUS_11700 110281 110448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 110479 111165 gene locus_tag LOCUS_11710 gene thyX 110479 111165 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393959.1 protein_id gnl|my_center|LOCUS_11710 111149 111670 gene locus_tag LOCUS_11720 111149 111670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 111672 112202 gene locus_tag LOCUS_11730 111672 112202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 112204 112746 gene locus_tag LOCUS_11740 112204 112746 CDS product 5'-3'-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399368.1 protein_id gnl|my_center|LOCUS_11740 112763 114052 gene locus_tag LOCUS_11750 112763 114052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 114168 114935 gene locus_tag LOCUS_11760 114168 114935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 115387 116094 gene locus_tag LOCUS_11770 115387 116094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 116228 116620 gene locus_tag LOCUS_11780 116228 116620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 116622 116783 gene locus_tag LOCUS_11790 116622 116783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 116796 117344 gene locus_tag LOCUS_11800 116796 117344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 117372 118193 gene locus_tag LOCUS_11810 gene folD 117372 118193 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230259.1 protein_id gnl|my_center|LOCUS_11810 118190 118699 gene locus_tag LOCUS_11820 118190 118699 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002265011.1 protein_id gnl|my_center|LOCUS_11820 118711 118968 gene locus_tag LOCUS_11830 118711 118968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 118969 119277 gene locus_tag LOCUS_11840 118969 119277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 119361 119630 gene locus_tag LOCUS_11850 119361 119630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 119623 120063 gene locus_tag LOCUS_11860 119623 120063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 120076 120294 gene locus_tag LOCUS_11870 120076 120294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 120387 121658 gene locus_tag LOCUS_11880 120387 121658 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006906966.1 protein_id gnl|my_center|LOCUS_11880 122615 121932 gene locus_tag LOCUS_11890 122615 121932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 123190 122615 gene locus_tag LOCUS_11900 123190 122615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 123493 123200 gene locus_tag LOCUS_11910 123493 123200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 124041 123490 gene locus_tag LOCUS_11920 124041 123490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 124337 124053 gene locus_tag LOCUS_11930 124337 124053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024889622.1 protein_id gnl|my_center|LOCUS_11930 125746 124349 gene locus_tag LOCUS_11940 125746 124349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 126182 125730 gene locus_tag LOCUS_11950 126182 125730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 126907 126257 gene locus_tag LOCUS_11960 126907 126257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 127131 126922 gene locus_tag LOCUS_11970 127131 126922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 128238 127144 gene locus_tag LOCUS_11980 128238 127144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 129008 128235 gene locus_tag LOCUS_11990 129008 128235 CDS product PRTRC system ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108426.1 protein_id gnl|my_center|LOCUS_11990 130396 129005 gene locus_tag LOCUS_12000 130396 129005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 130917 130678 gene locus_tag LOCUS_12010 130917 130678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 131117 130914 gene locus_tag LOCUS_12020 131117 130914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 132758 131178 gene locus_tag LOCUS_12030 132758 131178 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048176.1 protein_id gnl|my_center|LOCUS_12030 133141 132827 gene locus_tag LOCUS_12040 133141 132827 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814555.1 protein_id gnl|my_center|LOCUS_12040 133429 133142 gene locus_tag LOCUS_12050 133429 133142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 133949 133527 gene locus_tag LOCUS_12060 133949 133527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 134465 134007 gene locus_tag LOCUS_12070 gene ssb 134465 134007 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934759.1 protein_id gnl|my_center|LOCUS_12070 134955 134488 gene locus_tag LOCUS_12080 134955 134488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 136401 135064 gene locus_tag LOCUS_12090 136401 135064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 136660 136391 gene locus_tag LOCUS_12100 136660 136391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 137062 136715 gene locus_tag LOCUS_12110 137062 136715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 137252 137067 gene locus_tag LOCUS_12120 137252 137067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 137647 137249 gene locus_tag LOCUS_12130 137647 137249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 138803 137661 gene locus_tag LOCUS_12140 138803 137661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 141898 138818 gene locus_tag LOCUS_12150 141898 138818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 142693 142145 gene locus_tag LOCUS_12160 142693 142145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 143279 142683 gene locus_tag LOCUS_12170 143279 142683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 143421 143726 gene locus_tag LOCUS_12180 143421 143726 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944876.1 protein_id gnl|my_center|LOCUS_12180 145060 143765 gene locus_tag LOCUS_12190 145060 143765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 145619 145086 gene locus_tag LOCUS_12200 145619 145086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 146629 145622 gene locus_tag LOCUS_12210 146629 145622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 146712 146921 gene locus_tag LOCUS_12220 146712 146921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 149049 146971 gene locus_tag LOCUS_12230 149049 146971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 150112 148979 gene locus_tag LOCUS_12240 150112 148979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 151066 150386 gene locus_tag LOCUS_12250 151066 150386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 153009 151063 gene locus_tag LOCUS_12260 153009 151063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 154378 153710 gene locus_tag LOCUS_12270 154378 153710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 154677 154375 gene locus_tag LOCUS_12280 154677 154375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 154939 154670 gene locus_tag LOCUS_12290 154939 154670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 156082 154955 gene locus_tag LOCUS_12300 156082 154955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 158555 156075 gene locus_tag LOCUS_12310 158555 156075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 159485 159114 gene locus_tag LOCUS_12320 159485 159114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 159546 159698 gene locus_tag LOCUS_12330 159546 159698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 159721 160455 gene locus_tag LOCUS_12340 159721 160455 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662263.1 protein_id gnl|my_center|LOCUS_12340 161067 160459 gene locus_tag LOCUS_12350 161067 160459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 169766 161133 gene locus_tag LOCUS_12360 169766 161133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 171048 169906 gene locus_tag LOCUS_12370 171048 169906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 172071 171247 gene locus_tag LOCUS_12380 172071 171247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 172979 172068 gene locus_tag LOCUS_12390 172979 172068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 173454 173059 gene locus_tag LOCUS_12400 173454 173059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 173852 173469 gene locus_tag LOCUS_12410 173852 173469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 174011 174844 gene locus_tag LOCUS_12420 174011 174844 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475480.1 protein_id gnl|my_center|LOCUS_12420 175889 174894 gene locus_tag LOCUS_12430 175889 174894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 176706 175882 gene locus_tag LOCUS_12440 176706 175882 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648604.1 protein_id gnl|my_center|LOCUS_12440 177004 176762 gene locus_tag LOCUS_12450 177004 176762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 177219 177070 gene locus_tag LOCUS_12460 177219 177070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 179144 177216 gene locus_tag LOCUS_12470 179144 177216 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038053.1 protein_id gnl|my_center|LOCUS_12470 179839 179531 gene locus_tag LOCUS_12480 179839 179531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 180457 180251 gene locus_tag LOCUS_12490 180457 180251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 180717 180406 gene locus_tag LOCUS_12500 180717 180406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 182255 180891 gene locus_tag LOCUS_12510 182255 180891 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860801.1 protein_id gnl|my_center|LOCUS_12510 183092 182334 gene locus_tag LOCUS_12520 183092 182334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 183511 183089 gene locus_tag LOCUS_12530 183511 183089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 184257 183508 gene locus_tag LOCUS_12540 184257 183508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 185179 184247 gene locus_tag LOCUS_12550 185179 184247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 185550 185179 gene locus_tag LOCUS_12560 185550 185179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 189592 185648 gene locus_tag LOCUS_12570 189592 185648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 190044 189649 gene locus_tag LOCUS_12580 190044 189649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 190967 190134 gene locus_tag LOCUS_12590 190967 190134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 191934 191083 gene locus_tag LOCUS_12600 191934 191083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 192922 191939 gene locus_tag LOCUS_12610 192922 191939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 193885 192971 gene locus_tag LOCUS_12620 193885 192971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 194468 194043 gene locus_tag LOCUS_12630 194468 194043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 194955 194869 gene locus_tag LOCUS_t00270 194955 194869 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 195465 195392 gene locus_tag LOCUS_t00280 195465 195392 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence005 944 594 gene locus_tag LOCUS_12640 944 594 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436216.1 protein_id gnl|my_center|LOCUS_12640 1122 1640 gene locus_tag LOCUS_12650 1122 1640 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429152.1 protein_id gnl|my_center|LOCUS_12650 2080 1751 gene locus_tag LOCUS_12660 2080 1751 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965858.1 protein_id gnl|my_center|LOCUS_12660 2207 3142 gene locus_tag LOCUS_12670 2207 3142 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878808.1 protein_id gnl|my_center|LOCUS_12670 3412 3879 gene locus_tag LOCUS_12680 3412 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 5611 4004 gene locus_tag LOCUS_12690 5611 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 6189 5608 gene locus_tag LOCUS_12700 gene sigK 6189 5608 CDS product sigma-70 family RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402246.1 protein_id gnl|my_center|LOCUS_12700 6911 6351 gene locus_tag LOCUS_12710 6911 6351 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080866.1 protein_id gnl|my_center|LOCUS_12710 7167 7700 gene locus_tag LOCUS_12720 7167 7700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358943.1 protein_id gnl|my_center|LOCUS_12720 7784 7859 gene locus_tag LOCUS_t00290 7784 7859 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9632 7941 gene locus_tag LOCUS_12730 9632 7941 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461447.1 protein_id gnl|my_center|LOCUS_12730 10113 9682 gene locus_tag LOCUS_12740 10113 9682 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460328.1 protein_id gnl|my_center|LOCUS_12740 10256 11188 gene locus_tag LOCUS_12750 gene cysK 10256 11188 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_12750 11726 11277 gene locus_tag LOCUS_12760 11726 11277 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986910.1 protein_id gnl|my_center|LOCUS_12760 12502 11741 gene locus_tag LOCUS_12770 12502 11741 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888325.1 protein_id gnl|my_center|LOCUS_12770 13280 12846 gene locus_tag LOCUS_12780 gene aroQ 13280 12846 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860435.1 protein_id gnl|my_center|LOCUS_12780 14571 13261 gene locus_tag LOCUS_12790 14571 13261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 15711 14575 gene locus_tag LOCUS_12800 gene pheA 15711 14575 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_12800 16789 15698 gene locus_tag LOCUS_12810 gene aroC 16789 15698 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964214.1 protein_id gnl|my_center|LOCUS_12810 18047 16779 gene locus_tag LOCUS_12820 gene aroA 18047 16779 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_12820 19129 18050 gene locus_tag LOCUS_12830 gene aroB 19129 18050 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382321.1 protein_id gnl|my_center|LOCUS_12830 20021 19185 gene locus_tag LOCUS_12840 20021 19185 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 protein_id gnl|my_center|LOCUS_12840 21038 20025 gene locus_tag LOCUS_12850 gene aroF 21038 20025 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439427.1 protein_id gnl|my_center|LOCUS_12850 21855 23138 gene locus_tag LOCUS_12860 21855 23138 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774915.1 protein_id gnl|my_center|LOCUS_12860 23158 24045 gene locus_tag LOCUS_12870 23158 24045 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939305.1 protein_id gnl|my_center|LOCUS_12870 24058 24897 gene locus_tag LOCUS_12880 24058 24897 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921761.1 protein_id gnl|my_center|LOCUS_12880 25087 27267 gene locus_tag LOCUS_12890 25087 27267 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584017.1 protein_id gnl|my_center|LOCUS_12890 28080 27343 gene locus_tag LOCUS_12900 28080 27343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12900 28413 28087 gene locus_tag LOCUS_12910 28413 28087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12910 28609 29229 gene locus_tag LOCUS_12920 28609 29229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 29492 30226 gene locus_tag LOCUS_12930 29492 30226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 30229 30435 gene locus_tag LOCUS_12940 30229 30435 CDS product transposon-transfer assisting family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861106.1 protein_id gnl|my_center|LOCUS_12940 30432 30797 gene locus_tag LOCUS_12950 30432 30797 CDS product cysteine-rich VLP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861105.1 protein_id gnl|my_center|LOCUS_12950 31226 30975 gene locus_tag LOCUS_12960 31226 30975 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861102.1 protein_id gnl|my_center|LOCUS_12960 32636 31290 gene locus_tag LOCUS_12970 32636 31290 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861101.1 protein_id gnl|my_center|LOCUS_12970 32926 32597 gene locus_tag LOCUS_12980 gene mobC 32926 32597 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861100.1 protein_id gnl|my_center|LOCUS_12980 33547 33194 gene locus_tag LOCUS_12990 33547 33194 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861099.1 protein_id gnl|my_center|LOCUS_12990 33932 34111 gene locus_tag LOCUS_13000 33932 34111 CDS product cysteine-rich KTR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001803271.1 protein_id gnl|my_center|LOCUS_13000 34135 35124 gene locus_tag LOCUS_13010 gene rlmN 34135 35124 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583788.1 protein_id gnl|my_center|LOCUS_13010 35375 35560 gene locus_tag LOCUS_13020 35375 35560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 35662 36102 gene locus_tag LOCUS_13030 35662 36102 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905239.1 protein_id gnl|my_center|LOCUS_13030 36083 36343 gene locus_tag LOCUS_13040 36083 36343 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905237.1 protein_id gnl|my_center|LOCUS_13040 36821 36988 gene locus_tag LOCUS_13050 36821 36988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 37089 38765 gene locus_tag LOCUS_13060 37089 38765 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_13060 40256 39042 gene locus_tag LOCUS_13070 40256 39042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 40504 40259 gene locus_tag LOCUS_13080 40504 40259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 40929 40591 gene locus_tag LOCUS_13090 40929 40591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 41715 40942 gene locus_tag LOCUS_13100 41715 40942 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804205.1 protein_id gnl|my_center|LOCUS_13100 42715 41789 gene locus_tag LOCUS_13110 42715 41789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 43972 42740 gene locus_tag LOCUS_13120 43972 42740 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_13120 45187 44003 gene locus_tag LOCUS_13130 45187 44003 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867899.1 protein_id gnl|my_center|LOCUS_13130 47125 45383 gene locus_tag LOCUS_13140 47125 45383 CDS product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671107.1 protein_id gnl|my_center|LOCUS_13140 48954 47119 gene locus_tag LOCUS_13150 48954 47119 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679271.1 protein_id gnl|my_center|LOCUS_13150 50040 49252 gene locus_tag LOCUS_13160 50040 49252 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339313.1 protein_id gnl|my_center|LOCUS_13160 50187 51128 gene locus_tag LOCUS_13170 50187 51128 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016517.1 protein_id gnl|my_center|LOCUS_13170 52660 51788 gene locus_tag LOCUS_13180 52660 51788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 55923 52597 gene locus_tag LOCUS_13190 55923 52597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 56692 56063 gene locus_tag LOCUS_13200 56692 56063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 56835 57101 gene locus_tag LOCUS_13210 56835 57101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 57932 57777 gene locus_tag LOCUS_13220 57932 57777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 58086 58244 gene locus_tag LOCUS_13230 58086 58244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 58341 60089 gene locus_tag LOCUS_13240 58341 60089 CDS product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268782.1 protein_id gnl|my_center|LOCUS_13240 60086 62230 gene locus_tag LOCUS_13250 60086 62230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 62341 62673 gene locus_tag LOCUS_13260 62341 62673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 63312 62719 gene locus_tag LOCUS_13270 63312 62719 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583630.1 protein_id gnl|my_center|LOCUS_13270 64136 63309 gene locus_tag LOCUS_13280 64136 63309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 64414 65745 gene locus_tag LOCUS_13290 64414 65745 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966626.1 protein_id gnl|my_center|LOCUS_13290 65945 67708 gene locus_tag LOCUS_13300 gene recQ 65945 67708 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272332.1 protein_id gnl|my_center|LOCUS_13300 67725 68585 gene locus_tag LOCUS_13310 67725 68585 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909131.1 protein_id gnl|my_center|LOCUS_13310 70429 68951 gene locus_tag LOCUS_13320 gene spoIVA 70429 68951 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392832.1 protein_id gnl|my_center|LOCUS_13320 71874 70708 gene locus_tag LOCUS_13330 gene thiI 71874 70708 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_13330 72770 71877 gene locus_tag LOCUS_13340 gene rsgA 72770 71877 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392430.1 protein_id gnl|my_center|LOCUS_13340 74827 72767 gene locus_tag LOCUS_13350 gene pknB 74827 72767 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087065956.1 protein_id gnl|my_center|LOCUS_13350 75608 74889 gene locus_tag LOCUS_13360 75608 74889 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648699.1 protein_id gnl|my_center|LOCUS_13360 76667 75642 gene locus_tag LOCUS_13370 gene rlmN 76667 75642 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965033.1 protein_id gnl|my_center|LOCUS_13370 78001 76673 gene locus_tag LOCUS_13380 gene rsmB 78001 76673 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_13380 78459 78091 gene locus_tag LOCUS_13390 78459 78091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 79382 78459 gene locus_tag LOCUS_13400 gene fmt 79382 78459 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392417.1 protein_id gnl|my_center|LOCUS_13400 79912 79379 gene locus_tag LOCUS_13410 gene def 79912 79379 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_13410 82396 79928 gene locus_tag LOCUS_13420 gene priA 82396 79928 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_13420 82706 82497 gene locus_tag LOCUS_13430 82706 82497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 83382 82777 gene locus_tag LOCUS_13440 gene gmk 83382 82777 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131468.1 protein_id gnl|my_center|LOCUS_13440 83642 83379 gene locus_tag LOCUS_13450 83642 83379 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965024.1 protein_id gnl|my_center|LOCUS_13450 84539 83661 gene locus_tag LOCUS_13460 84539 83661 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965023.1 protein_id gnl|my_center|LOCUS_13460 85084 84554 gene locus_tag LOCUS_13470 85084 84554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 85675 85085 gene locus_tag LOCUS_13480 85675 85085 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_13480 86538 85675 gene locus_tag LOCUS_13490 86538 85675 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_13490 86973 86551 gene locus_tag LOCUS_13500 86973 86551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 88209 86986 gene locus_tag LOCUS_13510 88209 86986 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461864.1 protein_id gnl|my_center|LOCUS_13510 89099 88206 gene locus_tag LOCUS_13520 gene cdaA 89099 88206 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966360.1 protein_id gnl|my_center|LOCUS_13520 90411 89284 gene locus_tag LOCUS_13530 90411 89284 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393701.1 protein_id gnl|my_center|LOCUS_13530 90662 90408 gene locus_tag LOCUS_13540 90662 90408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 90995 90747 gene locus_tag LOCUS_13550 90995 90747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 91237 91067 gene locus_tag LOCUS_13560 91237 91067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 92405 91935 gene locus_tag LOCUS_13570 gene ispF 92405 91935 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_13570 93154 92402 gene locus_tag LOCUS_13580 gene ispD 93154 92402 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942744.1 protein_id gnl|my_center|LOCUS_13580 93438 93154 gene locus_tag LOCUS_13590 93438 93154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 93995 93552 gene locus_tag LOCUS_13600 93995 93552 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_13600 94971 94237 gene locus_tag LOCUS_13610 94971 94237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 97095 95134 gene locus_tag LOCUS_13620 97095 95134 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965152.1 protein_id gnl|my_center|LOCUS_13620 97754 97092 gene locus_tag LOCUS_13630 97754 97092 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881346.1 protein_id gnl|my_center|LOCUS_13630 98428 97751 gene locus_tag LOCUS_13640 gene cmk 98428 97751 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729300.1 protein_id gnl|my_center|LOCUS_13640 98749 98591 gene locus_tag LOCUS_13650 98749 98591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 100113 98839 gene locus_tag LOCUS_13660 100113 98839 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_13660 100973 100110 gene locus_tag LOCUS_13670 100973 100110 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_13670 101801 101079 gene locus_tag LOCUS_13680 101801 101079 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_13680 102953 101835 gene locus_tag LOCUS_13690 gene dacB 102953 101835 CDS product D-alanyl-D-alanine carboxypeptidase DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230505.1 protein_id gnl|my_center|LOCUS_13690 103458 103030 gene locus_tag LOCUS_13700 gene ytfJ 103458 103030 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349990.1 protein_id gnl|my_center|LOCUS_13700 104112 103462 gene locus_tag LOCUS_13710 104112 103462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 104750 104109 gene locus_tag LOCUS_13720 gene scpB 104750 104109 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965360.1 protein_id gnl|my_center|LOCUS_13720 105586 104792 gene locus_tag LOCUS_13730 105586 104792 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_13730 106554 105961 gene locus_tag LOCUS_13740 gene yihA 106554 105961 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045119.1 protein_id gnl|my_center|LOCUS_13740 108996 106564 gene locus_tag LOCUS_13750 gene lon 108996 106564 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_13750 110438 109116 gene locus_tag LOCUS_13760 gene clpX 110438 109116 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357457.1 protein_id gnl|my_center|LOCUS_13760 111046 110465 gene locus_tag LOCUS_13770 gene clpP 111046 110465 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357557.1 protein_id gnl|my_center|LOCUS_13770 112538 111162 gene locus_tag LOCUS_13780 gene tig 112538 111162 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417090.1 protein_id gnl|my_center|LOCUS_13780 113611 112925 gene locus_tag LOCUS_13790 113611 112925 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963959.1 protein_id gnl|my_center|LOCUS_13790 115100 113616 gene locus_tag LOCUS_13800 gene thrC 115100 113616 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986278.1 protein_id gnl|my_center|LOCUS_13800 115566 115198 gene locus_tag LOCUS_13810 115566 115198 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223856.1 protein_id gnl|my_center|LOCUS_13810 116168 115563 gene locus_tag LOCUS_13820 116168 115563 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941310.1 protein_id gnl|my_center|LOCUS_13820 117213 116344 gene locus_tag LOCUS_13830 gene ylqF 117213 116344 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236704.1 protein_id gnl|my_center|LOCUS_13830 117899 117210 gene locus_tag LOCUS_13840 117899 117210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 118002 118775 gene locus_tag LOCUS_13850 118002 118775 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837282.1 protein_id gnl|my_center|LOCUS_13850 119873 118767 gene locus_tag LOCUS_13860 119873 118767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 120297 119956 gene locus_tag LOCUS_13870 gene rplS 120297 119956 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965066.1 protein_id gnl|my_center|LOCUS_13870 121225 120428 gene locus_tag LOCUS_13880 121225 120428 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338546.1 protein_id gnl|my_center|LOCUS_13880 121914 121213 gene locus_tag LOCUS_13890 121914 121213 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263081.1 protein_id gnl|my_center|LOCUS_13890 122501 121911 gene locus_tag LOCUS_13900 122501 121911 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861340.1 protein_id gnl|my_center|LOCUS_13900 124123 122606 gene locus_tag LOCUS_13910 124123 122606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 124408 124881 gene locus_tag LOCUS_13920 124408 124881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 125866 124946 gene locus_tag LOCUS_13930 125866 124946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 126342 125863 gene locus_tag LOCUS_13940 126342 125863 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809864.1 protein_id gnl|my_center|LOCUS_13940 127157 126996 gene locus_tag LOCUS_13950 127157 126996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 127684 127190 gene locus_tag LOCUS_13960 127684 127190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 127886 127802 gene locus_tag LOCUS_t00300 127886 127802 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 128357 127947 gene locus_tag LOCUS_13970 128357 127947 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935469.1 protein_id gnl|my_center|LOCUS_13970 128426 128665 gene locus_tag LOCUS_13980 128426 128665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 129491 128643 gene locus_tag LOCUS_13990 129491 128643 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767761.1 protein_id gnl|my_center|LOCUS_13990 130585 130061 gene locus_tag LOCUS_14000 130585 130061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 131087 130590 gene locus_tag LOCUS_14010 gene coaD 131087 130590 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388467.1 protein_id gnl|my_center|LOCUS_14010 131641 131084 gene locus_tag LOCUS_14020 gene rsmD 131641 131084 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_14020 133632 131812 gene locus_tag LOCUS_14030 gene uvrC 133632 131812 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_14030 133966 133703 gene locus_tag LOCUS_14040 133966 133703 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 protein_id gnl|my_center|LOCUS_14040 134329 134147 gene locus_tag LOCUS_14050 134329 134147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 134384 134860 gene locus_tag LOCUS_14060 134384 134860 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459411.1 protein_id gnl|my_center|LOCUS_14060 134857 136287 gene locus_tag LOCUS_14070 134857 136287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 138682 136316 gene locus_tag LOCUS_14080 138682 136316 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048130.1 protein_id gnl|my_center|LOCUS_14080 139323 138877 gene locus_tag LOCUS_14090 139323 138877 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890791.1 protein_id gnl|my_center|LOCUS_14090 139442 140581 gene locus_tag LOCUS_14100 139442 140581 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066524.1 protein_id gnl|my_center|LOCUS_14100 141800 140691 gene locus_tag LOCUS_14110 141800 140691 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814484.1 protein_id gnl|my_center|LOCUS_14110 143152 141800 gene locus_tag LOCUS_14120 gene rpoN 143152 141800 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819250.1 protein_id gnl|my_center|LOCUS_14120 145556 143223 gene locus_tag LOCUS_14130 145556 143223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 146497 145670 gene locus_tag LOCUS_14140 146497 145670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 146926 146513 gene locus_tag LOCUS_14150 146926 146513 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003050138.1 protein_id gnl|my_center|LOCUS_14150 148338 146926 gene locus_tag LOCUS_14160 gene atpD 148338 146926 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_14160 149244 148345 gene locus_tag LOCUS_14170 gene atpG 149244 148345 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_14170 150997 149237 gene locus_tag LOCUS_14180 gene atpA 150997 149237 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356056.1 protein_id gnl|my_center|LOCUS_14180 151469 150987 gene locus_tag LOCUS_14190 151469 150987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 151850 151485 gene locus_tag LOCUS_14200 151850 151485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 152699 151869 gene locus_tag LOCUS_14210 152699 151869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 152970 152876 gene locus_tag LOCUS_t00310 152970 152876 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 154309 153008 gene locus_tag LOCUS_14220 154309 153008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 158913 154306 gene locus_tag LOCUS_14230 158913 154306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 160508 159300 gene locus_tag LOCUS_14240 160508 159300 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_14240 161192 160524 gene locus_tag LOCUS_14250 161192 160524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 161630 161211 gene locus_tag LOCUS_14260 161630 161211 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_14260 162955 161819 gene locus_tag LOCUS_14270 162955 161819 CDS product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902650.1 protein_id gnl|my_center|LOCUS_14270 164395 162959 gene locus_tag LOCUS_14280 164395 162959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 164563 164417 gene locus_tag LOCUS_14290 164563 164417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 164770 164594 gene locus_tag LOCUS_14300 164770 164594 CDS product DUF6440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895603.1 protein_id gnl|my_center|LOCUS_14300 165576 164785 gene locus_tag LOCUS_14310 165576 164785 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902652.1 protein_id gnl|my_center|LOCUS_14310 167476 165713 gene locus_tag LOCUS_14320 167476 165713 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902654.1 protein_id gnl|my_center|LOCUS_14320 167705 167535 gene locus_tag LOCUS_14330 167705 167535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 168508 167708 gene locus_tag LOCUS_14340 gene gctB 168508 167708 CDS product glutaconate CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902656.1 protein_id gnl|my_center|LOCUS_14340 169626 168529 gene locus_tag LOCUS_14350 gene gctA 169626 168529 CDS product glutaconate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902658.1 protein_id gnl|my_center|LOCUS_14350 169858 170700 gene locus_tag LOCUS_14360 169858 170700 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965896.1 protein_id gnl|my_center|LOCUS_14360 170782 172476 gene locus_tag LOCUS_14370 170782 172476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 172972 173304 gene locus_tag LOCUS_14380 172972 173304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 173823 173898 gene locus_tag LOCUS_t00320 173823 173898 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence006 450 55 gene locus_tag LOCUS_14390 450 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 1825 713 gene locus_tag LOCUS_14400 1825 713 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021367800.1 protein_id gnl|my_center|LOCUS_14400 2534 1815 gene locus_tag LOCUS_14410 gene vanR 2534 1815 CDS product vancomycin resistance response regulator transcriptoin factor VanR-G-Cd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436401.1 protein_id gnl|my_center|LOCUS_14410 2934 2536 gene locus_tag LOCUS_14420 2934 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 3171 3043 gene locus_tag LOCUS_14430 3171 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 5839 3455 gene locus_tag LOCUS_14440 5839 3455 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861587.1 protein_id gnl|my_center|LOCUS_14440 6519 5854 gene locus_tag LOCUS_14450 6519 5854 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861403.1 protein_id gnl|my_center|LOCUS_14450 7655 6630 gene locus_tag LOCUS_14460 7655 6630 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861402.1 protein_id gnl|my_center|LOCUS_14460 8341 7652 gene locus_tag LOCUS_14470 8341 7652 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861401.1 protein_id gnl|my_center|LOCUS_14470 9482 8466 gene locus_tag LOCUS_14480 9482 8466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 10173 9466 gene locus_tag LOCUS_14490 10173 9466 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227564.1 protein_id gnl|my_center|LOCUS_14490 10352 10176 gene locus_tag LOCUS_14500 10352 10176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 11015 10506 gene locus_tag LOCUS_14510 11015 10506 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721853.1 protein_id gnl|my_center|LOCUS_14510 11909 11100 gene locus_tag LOCUS_14520 11909 11100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 12054 12368 gene locus_tag LOCUS_14530 12054 12368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 12615 13619 gene locus_tag LOCUS_14540 12615 13619 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_14540 13701 15464 gene locus_tag LOCUS_14550 13701 15464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 15461 16780 gene locus_tag LOCUS_14560 gene rpoD 15461 16780 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_14560 16838 19978 gene locus_tag LOCUS_14570 16838 19978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 20697 20026 gene locus_tag LOCUS_14580 gene rnc 20697 20026 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354946.1 protein_id gnl|my_center|LOCUS_14580 21015 20782 gene locus_tag LOCUS_14590 gene acpP 21015 20782 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_14590 22478 21081 gene locus_tag LOCUS_14600 22478 21081 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921831.1 protein_id gnl|my_center|LOCUS_14600 23285 22794 gene locus_tag LOCUS_14610 23285 22794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 23584 24534 gene locus_tag LOCUS_14620 23584 24534 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480277.1 protein_id gnl|my_center|LOCUS_14620 24767 24582 gene locus_tag LOCUS_14630 24767 24582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 25306 25070 gene locus_tag LOCUS_14640 25306 25070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 25344 26189 gene locus_tag LOCUS_14650 25344 26189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14650 26205 26810 gene locus_tag LOCUS_14660 26205 26810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14660 28304 27069 gene locus_tag LOCUS_14670 28304 27069 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054321935.1 protein_id gnl|my_center|LOCUS_14670 29751 28324 gene locus_tag LOCUS_14680 29751 28324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 30029 30460 gene locus_tag LOCUS_14690 30029 30460 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970935.1 protein_id gnl|my_center|LOCUS_14690 33182 30528 gene locus_tag LOCUS_14700 33182 30528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 33588 33403 gene locus_tag LOCUS_14710 33588 33403 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811990.1 protein_id gnl|my_center|LOCUS_14710 34945 33641 gene locus_tag LOCUS_14720 34945 33641 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810397.1 protein_id gnl|my_center|LOCUS_14720 35157 35399 gene locus_tag LOCUS_14730 35157 35399 CDS product 50S ribosomal protein L7ae-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048355.1 protein_id gnl|my_center|LOCUS_14730 35603 36025 gene locus_tag LOCUS_14740 gene rpsL 35603 36025 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142340.1 protein_id gnl|my_center|LOCUS_14740 36187 36657 gene locus_tag LOCUS_14750 gene rpsG 36187 36657 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357613.1 protein_id gnl|my_center|LOCUS_14750 36673 38778 gene locus_tag LOCUS_14760 gene fusA 36673 38778 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_14760 38884 40086 gene locus_tag LOCUS_14770 gene tuf 38884 40086 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723640.1 protein_id gnl|my_center|LOCUS_14770 40262 40903 gene locus_tag LOCUS_14780 40262 40903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 41395 42504 gene locus_tag LOCUS_14790 41395 42504 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945303.1 protein_id gnl|my_center|LOCUS_14790 42777 43721 gene locus_tag LOCUS_14800 42777 43721 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461074.1 protein_id gnl|my_center|LOCUS_14800 43723 44508 gene locus_tag LOCUS_14810 43723 44508 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808997.1 protein_id gnl|my_center|LOCUS_14810 44811 45326 gene locus_tag LOCUS_14820 44811 45326 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459411.1 protein_id gnl|my_center|LOCUS_14820 45301 45939 gene locus_tag LOCUS_14830 45301 45939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 46060 46950 gene locus_tag LOCUS_14840 46060 46950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056248.1 protein_id gnl|my_center|LOCUS_14840 47006 47188 gene locus_tag LOCUS_14850 47006 47188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 48093 47266 gene locus_tag LOCUS_14860 48093 47266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 48713 48123 gene locus_tag LOCUS_14870 gene rsxA 48713 48123 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761247.1 protein_id gnl|my_center|LOCUS_14870 50387 48729 gene locus_tag LOCUS_14880 50387 48729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 51709 50384 gene locus_tag LOCUS_14890 gene rsxC 51709 50384 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339117.1 protein_id gnl|my_center|LOCUS_14890 52249 52668 gene locus_tag LOCUS_14900 52249 52668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 53336 52710 gene locus_tag LOCUS_14910 53336 52710 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186912.1 protein_id gnl|my_center|LOCUS_14910 53801 54778 gene locus_tag LOCUS_14920 53801 54778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 54843 55601 gene locus_tag LOCUS_14930 54843 55601 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813595.1 protein_id gnl|my_center|LOCUS_14930 57197 55641 gene locus_tag LOCUS_14940 57197 55641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 57594 59237 gene locus_tag LOCUS_14950 57594 59237 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129256806.1 protein_id gnl|my_center|LOCUS_14950 59963 59334 gene locus_tag LOCUS_14960 59963 59334 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519103.1 protein_id gnl|my_center|LOCUS_14960 60181 59960 gene locus_tag LOCUS_14970 60181 59960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 60295 61554 gene locus_tag LOCUS_14980 gene leuC 60295 61554 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_14980 61707 62192 gene locus_tag LOCUS_14990 gene leuD 61707 62192 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_14990 62192 62512 gene locus_tag LOCUS_15000 62192 62512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 62516 63040 gene locus_tag LOCUS_15010 62516 63040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 63044 64120 gene locus_tag LOCUS_15020 gene leuB 63044 64120 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861060.1 protein_id gnl|my_center|LOCUS_15020 64836 64192 gene locus_tag LOCUS_15030 64836 64192 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433837.1 protein_id gnl|my_center|LOCUS_15030 66291 64927 gene locus_tag LOCUS_15040 66291 64927 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811039.1 protein_id gnl|my_center|LOCUS_15040 66429 66830 gene locus_tag LOCUS_15050 66429 66830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 66959 67645 gene locus_tag LOCUS_15060 66959 67645 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_15060 67642 69120 gene locus_tag LOCUS_15070 67642 69120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 69117 69629 gene locus_tag LOCUS_15080 69117 69629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 69804 70604 gene locus_tag LOCUS_15090 69804 70604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 70617 71132 gene locus_tag LOCUS_15100 70617 71132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 71191 72474 gene locus_tag LOCUS_15110 71191 72474 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_15110 72493 72876 gene locus_tag LOCUS_15120 72493 72876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 73752 73138 gene locus_tag LOCUS_15130 73752 73138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 74181 73759 gene locus_tag LOCUS_15140 gene ruvX 74181 73759 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730148.1 protein_id gnl|my_center|LOCUS_15140 74472 75455 gene locus_tag LOCUS_15150 74472 75455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 75605 76861 gene locus_tag LOCUS_15160 75605 76861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 76961 77416 gene locus_tag LOCUS_15170 gene nrdR 76961 77416 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_15170 77485 77823 gene locus_tag LOCUS_15180 77485 77823 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461224.1 protein_id gnl|my_center|LOCUS_15180 78882 77965 gene locus_tag LOCUS_15190 gene gluQRS 78882 77965 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 protein_id gnl|my_center|LOCUS_15190 79246 78869 gene locus_tag LOCUS_15200 79246 78869 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227791.1 protein_id gnl|my_center|LOCUS_15200 79704 81485 gene locus_tag LOCUS_15210 79704 81485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 81547 84207 gene locus_tag LOCUS_15220 81547 84207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 84486 84920 gene locus_tag LOCUS_15230 84486 84920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 85076 86080 gene locus_tag LOCUS_15240 85076 86080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 86194 87360 gene locus_tag LOCUS_15250 86194 87360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 87649 87470 gene locus_tag LOCUS_15260 87649 87470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 87983 89041 gene locus_tag LOCUS_15270 gene hrcA 87983 89041 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392120.1 protein_id gnl|my_center|LOCUS_15270 89069 89638 gene locus_tag LOCUS_15280 gene grpE 89069 89638 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964593.1 protein_id gnl|my_center|LOCUS_15280 90035 91882 gene locus_tag LOCUS_15290 gene dnaK 90035 91882 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_15290 92067 93212 gene locus_tag LOCUS_15300 gene dnaJ 92067 93212 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142730484.1 protein_id gnl|my_center|LOCUS_15300 93568 93257 gene locus_tag LOCUS_15310 gene trxA 93568 93257 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878779.1 protein_id gnl|my_center|LOCUS_15310 94478 93603 gene locus_tag LOCUS_15320 94478 93603 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357673.1 protein_id gnl|my_center|LOCUS_15320 94791 96494 gene locus_tag LOCUS_15330 gene glnS 94791 96494 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287115.1 protein_id gnl|my_center|LOCUS_15330 97049 96531 gene locus_tag LOCUS_15340 97049 96531 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462102.1 protein_id gnl|my_center|LOCUS_15340 98129 97203 gene locus_tag LOCUS_15350 98129 97203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 98457 98975 gene locus_tag LOCUS_15360 98457 98975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 99129 99617 gene locus_tag LOCUS_15370 gene nuoE 99129 99617 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582933.1 protein_id gnl|my_center|LOCUS_15370 99610 101508 gene locus_tag LOCUS_15380 gene nuoF 99610 101508 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082447.1 protein_id gnl|my_center|LOCUS_15380 101514 103211 gene locus_tag LOCUS_15390 101514 103211 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_15390 104428 103247 gene locus_tag LOCUS_15400 104428 103247 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966117.1 protein_id gnl|my_center|LOCUS_15400 104680 105441 gene locus_tag LOCUS_15410 104680 105441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 105786 106160 gene locus_tag LOCUS_15420 105786 106160 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379711.1 protein_id gnl|my_center|LOCUS_15420 106438 108549 gene locus_tag LOCUS_15430 106438 108549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 108591 109067 gene locus_tag LOCUS_15440 108591 109067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 111434 109122 gene locus_tag LOCUS_15450 111434 109122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 111810 111427 gene locus_tag LOCUS_15460 111810 111427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 112163 113119 gene locus_tag LOCUS_15470 112163 113119 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530643.1 protein_id gnl|my_center|LOCUS_15470 113208 115241 gene locus_tag LOCUS_15480 113208 115241 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_15480 115429 116286 gene locus_tag LOCUS_15490 gene rfbA 115429 116286 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877393.1 protein_id gnl|my_center|LOCUS_15490 116297 117298 gene locus_tag LOCUS_15500 gene ansA 116297 117298 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399032.1 protein_id gnl|my_center|LOCUS_15500 117317 119284 gene locus_tag LOCUS_15510 117317 119284 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878377.1 protein_id gnl|my_center|LOCUS_15510 119356 120204 gene locus_tag LOCUS_15520 119356 120204 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932161.1 protein_id gnl|my_center|LOCUS_15520 120197 121582 gene locus_tag LOCUS_15530 gene gltA 120197 121582 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_15530 121635 122513 gene locus_tag LOCUS_15540 121635 122513 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213640.1 protein_id gnl|my_center|LOCUS_15540 123161 122553 gene locus_tag LOCUS_15550 123161 122553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 124963 123161 gene locus_tag LOCUS_15560 gene rqcH 124963 123161 CDS product tRNA modification protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886504.1 protein_id gnl|my_center|LOCUS_15560 125517 124984 gene locus_tag LOCUS_15570 125517 124984 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989391.1 protein_id gnl|my_center|LOCUS_15570 125922 125521 gene locus_tag LOCUS_15580 125922 125521 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393960.1 protein_id gnl|my_center|LOCUS_15580 125921 126094 gene locus_tag LOCUS_15590 125921 126094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 126180 128483 gene locus_tag LOCUS_15600 126180 128483 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229052.1 protein_id gnl|my_center|LOCUS_15600 128651 128520 gene locus_tag LOCUS_15610 128651 128520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 128635 129663 gene locus_tag LOCUS_15620 128635 129663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 129774 130361 gene locus_tag LOCUS_15630 129774 130361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 130488 131357 gene locus_tag LOCUS_15640 gene spoIIGA 130488 131357 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170291042.1 protein_id gnl|my_center|LOCUS_15640 131443 132174 gene locus_tag LOCUS_15650 gene sigE 131443 132174 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976948.1 protein_id gnl|my_center|LOCUS_15650 132372 132217 gene locus_tag LOCUS_15660 132372 132217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 132601 132738 gene locus_tag LOCUS_15670 132601 132738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 132755 133408 gene locus_tag LOCUS_15680 132755 133408 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966000.1 protein_id gnl|my_center|LOCUS_15680 133405 134493 gene locus_tag LOCUS_15690 133405 134493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 134586 134738 gene locus_tag LOCUS_15700 134586 134738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 135048 136355 gene locus_tag LOCUS_15710 gene rsxC 135048 136355 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_15710 136355 137302 gene locus_tag LOCUS_15720 136355 137302 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583454.1 protein_id gnl|my_center|LOCUS_15720 137299 137841 gene locus_tag LOCUS_15730 137299 137841 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869097.1 protein_id gnl|my_center|LOCUS_15730 137859 138536 gene locus_tag LOCUS_15740 137859 138536 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869098.1 protein_id gnl|my_center|LOCUS_15740 138536 139150 gene locus_tag LOCUS_15750 gene rsxA 138536 139150 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_15750 139169 139969 gene locus_tag LOCUS_15760 139169 139969 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_15760 141270 140065 gene locus_tag LOCUS_15770 gene rodA 141270 140065 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_15770 141391 141816 gene locus_tag LOCUS_15780 gene tsaE 141391 141816 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_15780 141813 142550 gene locus_tag LOCUS_15790 gene tsaB 141813 142550 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966124.1 protein_id gnl|my_center|LOCUS_15790 142543 143178 gene locus_tag LOCUS_15800 gene upp 142543 143178 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815407.1 protein_id gnl|my_center|LOCUS_15800 143217 143420 gene locus_tag LOCUS_15810 143217 143420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 143837 145321 gene locus_tag LOCUS_15820 143837 145321 CDS product Lsa family ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963849.1 protein_id gnl|my_center|LOCUS_15820 145727 145362 gene locus_tag LOCUS_15830 145727 145362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 146061 146216 gene locus_tag LOCUS_15840 146061 146216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 146894 146415 gene locus_tag LOCUS_15850 146894 146415 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_15850 147289 146897 gene locus_tag LOCUS_15860 147289 146897 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_15860 148650 147373 gene locus_tag LOCUS_15870 148650 147373 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966034.1 protein_id gnl|my_center|LOCUS_15870 149549 148809 gene locus_tag LOCUS_15880 149549 148809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 149786 150499 gene locus_tag LOCUS_15890 gene pyrH 149786 150499 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_15890 150471 150656 gene locus_tag LOCUS_15900 150471 150656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 150678 151232 gene locus_tag LOCUS_15910 gene frr 150678 151232 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159519.1 protein_id gnl|my_center|LOCUS_15910 151261 151434 gene locus_tag LOCUS_15920 151261 151434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 151500 152246 gene locus_tag LOCUS_15930 151500 152246 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_15930 152248 153066 gene locus_tag LOCUS_15940 152248 153066 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434000.1 protein_id gnl|my_center|LOCUS_15940 153398 153610 gene locus_tag LOCUS_15950 153398 153610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 153690 154754 gene locus_tag LOCUS_15960 gene rseP 153690 154754 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965102.1 protein_id gnl|my_center|LOCUS_15960 154771 155811 gene locus_tag LOCUS_15970 gene ispG 154771 155811 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_15970 155874 159998 gene locus_tag LOCUS_15980 155874 159998 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986794.1 protein_id gnl|my_center|LOCUS_15980 >Feature sequence007 169 540 gene locus_tag LOCUS_15990 169 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 480 671 gene locus_tag LOCUS_16000 480 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 2252 1293 gene locus_tag LOCUS_16010 2252 1293 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083086.1 protein_id gnl|my_center|LOCUS_16010 2983 2282 gene locus_tag LOCUS_16020 2983 2282 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368484.1 protein_id gnl|my_center|LOCUS_16020 3123 4079 gene locus_tag LOCUS_16030 3123 4079 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964364.1 protein_id gnl|my_center|LOCUS_16030 5615 4107 gene locus_tag LOCUS_16040 5615 4107 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903081.1 protein_id gnl|my_center|LOCUS_16040 6080 5634 gene locus_tag LOCUS_16050 6080 5634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 7180 6167 gene locus_tag LOCUS_16060 7180 6167 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816965.1 protein_id gnl|my_center|LOCUS_16060 7792 7232 gene locus_tag LOCUS_16070 7792 7232 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870105.1 protein_id gnl|my_center|LOCUS_16070 8912 7935 gene locus_tag LOCUS_16080 8912 7935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 9924 8926 gene locus_tag LOCUS_16090 gene dmpG 9924 8926 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257235.1 protein_id gnl|my_center|LOCUS_16090 10096 11061 gene locus_tag LOCUS_16100 10096 11061 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064418.1 protein_id gnl|my_center|LOCUS_16100 11245 11072 gene locus_tag LOCUS_16110 11245 11072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 11733 11317 gene locus_tag LOCUS_16120 11733 11317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16120 12056 11799 gene locus_tag LOCUS_16130 12056 11799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 12518 13192 gene locus_tag LOCUS_16140 12518 13192 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860834.1 protein_id gnl|my_center|LOCUS_16140 13240 14463 gene locus_tag LOCUS_16150 13240 14463 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021366129.1 protein_id gnl|my_center|LOCUS_16150 14473 14946 gene locus_tag LOCUS_16160 14473 14946 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261902.1 protein_id gnl|my_center|LOCUS_16160 15084 16118 gene locus_tag LOCUS_16170 15084 16118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 16121 17287 gene locus_tag LOCUS_16180 16121 17287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 17536 18423 gene locus_tag LOCUS_16190 17536 18423 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861379.1 protein_id gnl|my_center|LOCUS_16190 18401 19621 gene locus_tag LOCUS_16200 18401 19621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 19618 21618 gene locus_tag LOCUS_16210 19618 21618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 21833 23242 gene locus_tag LOCUS_16220 21833 23242 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_16220 23748 23299 gene locus_tag LOCUS_16230 23748 23299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 26369 24219 gene locus_tag LOCUS_16240 gene pnp 26369 24219 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_16240 26915 26649 gene locus_tag LOCUS_16250 gene rpsO 26915 26649 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257912.1 protein_id gnl|my_center|LOCUS_16250 27362 27514 gene locus_tag LOCUS_16260 27362 27514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 28472 27660 gene locus_tag LOCUS_16270 28472 27660 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047741.1 protein_id gnl|my_center|LOCUS_16270 29675 28485 gene locus_tag LOCUS_16280 29675 28485 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679364.1 protein_id gnl|my_center|LOCUS_16280 30714 29941 gene locus_tag LOCUS_16290 30714 29941 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029015.1 protein_id gnl|my_center|LOCUS_16290 31748 30717 gene locus_tag LOCUS_16300 31748 30717 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667996.1 protein_id gnl|my_center|LOCUS_16300 33554 31806 gene locus_tag LOCUS_16310 33554 31806 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948081.1 protein_id gnl|my_center|LOCUS_16310 33918 35309 gene locus_tag LOCUS_16320 33918 35309 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454077.1 protein_id gnl|my_center|LOCUS_16320 35609 36334 gene locus_tag LOCUS_16330 35609 36334 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113632.1 protein_id gnl|my_center|LOCUS_16330 36371 36592 gene locus_tag LOCUS_16340 36371 36592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 36593 37543 gene locus_tag LOCUS_16350 gene glsA 36593 37543 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417962.1 protein_id gnl|my_center|LOCUS_16350 37564 39009 gene locus_tag LOCUS_16360 37564 39009 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356603.1 protein_id gnl|my_center|LOCUS_16360 40781 39126 gene locus_tag LOCUS_16370 gene ptsP 40781 39126 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051542.1 protein_id gnl|my_center|LOCUS_16370 41120 40857 gene locus_tag LOCUS_16380 41120 40857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 42007 41174 gene locus_tag LOCUS_16390 42007 41174 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369253.1 protein_id gnl|my_center|LOCUS_16390 43872 42004 gene locus_tag LOCUS_16400 43872 42004 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258398.1 protein_id gnl|my_center|LOCUS_16400 44828 43893 gene locus_tag LOCUS_16410 44828 43893 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968826.1 protein_id gnl|my_center|LOCUS_16410 46775 44889 gene locus_tag LOCUS_16420 46775 44889 CDS product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963745.1 protein_id gnl|my_center|LOCUS_16420 47870 46890 gene locus_tag LOCUS_16430 47870 46890 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267463.1 protein_id gnl|my_center|LOCUS_16430 50879 48111 gene locus_tag LOCUS_16440 gene ileS 50879 48111 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_16440 51162 50908 gene locus_tag LOCUS_16450 51162 50908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 51779 51177 gene locus_tag LOCUS_16460 51779 51177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 52156 51797 gene locus_tag LOCUS_16470 52156 51797 CDS product Imm51 family immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787134.1 protein_id gnl|my_center|LOCUS_16470 52932 52180 gene locus_tag LOCUS_16480 52932 52180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 53904 52948 gene locus_tag LOCUS_16490 53904 52948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 54427 54260 gene locus_tag LOCUS_16500 54427 54260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 55406 54498 gene locus_tag LOCUS_16510 55406 54498 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542473.1 protein_id gnl|my_center|LOCUS_16510 55872 55381 gene locus_tag LOCUS_16520 gene lspA 55872 55381 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364048.1 protein_id gnl|my_center|LOCUS_16520 57719 56172 gene locus_tag LOCUS_16530 gene rny 57719 56172 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_16530 57863 57729 gene locus_tag LOCUS_16540 57863 57729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 58246 63036 gene locus_tag LOCUS_16550 58246 63036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986914.1 protein_id gnl|my_center|LOCUS_16550 63050 64129 gene locus_tag LOCUS_16560 63050 64129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 64157 65398 gene locus_tag LOCUS_16570 64157 65398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986915.1 protein_id gnl|my_center|LOCUS_16570 65425 65868 gene locus_tag LOCUS_16580 65425 65868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 65882 66943 gene locus_tag LOCUS_16590 65882 66943 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986916.1 protein_id gnl|my_center|LOCUS_16590 67757 66999 gene locus_tag LOCUS_16600 67757 66999 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360546.1 protein_id gnl|my_center|LOCUS_16600 67910 68347 gene locus_tag LOCUS_16610 gene rpiB 67910 68347 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966164.1 protein_id gnl|my_center|LOCUS_16610 68910 69038 gene locus_tag LOCUS_16620 68910 69038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 70900 69242 gene locus_tag LOCUS_16630 70900 69242 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385808.1 protein_id gnl|my_center|LOCUS_16630 73659 71296 gene locus_tag LOCUS_16640 73659 71296 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393425.1 protein_id gnl|my_center|LOCUS_16640 73886 74218 gene locus_tag LOCUS_16650 73886 74218 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396628.1 protein_id gnl|my_center|LOCUS_16650 74343 75335 gene locus_tag LOCUS_16660 74343 75335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 75445 75867 gene locus_tag LOCUS_16670 75445 75867 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437174.1 protein_id gnl|my_center|LOCUS_16670 75905 76879 gene locus_tag LOCUS_16680 75905 76879 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_16680 76907 77032 gene locus_tag LOCUS_16690 76907 77032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 77130 77765 gene locus_tag LOCUS_16700 77130 77765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 77895 78113 gene locus_tag LOCUS_16710 77895 78113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 78366 78190 gene locus_tag LOCUS_16720 78366 78190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 78776 78685 gene locus_tag LOCUS_t00330 78776 78685 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 78994 78908 gene locus_tag LOCUS_t00340 78994 78908 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 81967 79322 gene locus_tag LOCUS_16730 81967 79322 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643866.1 protein_id gnl|my_center|LOCUS_16730 82211 82297 gene locus_tag LOCUS_t00350 82211 82297 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 82517 82717 gene locus_tag LOCUS_16740 82517 82717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 83159 82734 gene locus_tag LOCUS_16750 83159 82734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722815.1 protein_id gnl|my_center|LOCUS_16750 83336 83671 gene locus_tag LOCUS_16760 83336 83671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 83575 83979 gene locus_tag LOCUS_16770 83575 83979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16770 83981 85228 gene locus_tag LOCUS_16780 83981 85228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 85246 86508 gene locus_tag LOCUS_16790 85246 86508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 87794 86595 gene locus_tag LOCUS_16800 87794 86595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 88796 88035 gene locus_tag LOCUS_16810 88796 88035 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810589.1 protein_id gnl|my_center|LOCUS_16810 89403 88915 gene locus_tag LOCUS_16820 89403 88915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 90794 89400 gene locus_tag LOCUS_16830 90794 89400 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048439.1 protein_id gnl|my_center|LOCUS_16830 91336 90941 gene locus_tag LOCUS_16840 91336 90941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386950.1 protein_id gnl|my_center|LOCUS_16840 91549 92034 gene locus_tag LOCUS_16850 91549 92034 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966160.1 protein_id gnl|my_center|LOCUS_16850 92167 93102 gene locus_tag LOCUS_16860 92167 93102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 94194 93148 gene locus_tag LOCUS_16870 94194 93148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 94944 94249 gene locus_tag LOCUS_16880 94944 94249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 95572 94946 gene locus_tag LOCUS_16890 95572 94946 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_16890 95774 96016 gene locus_tag LOCUS_16900 95774 96016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 96392 97501 gene locus_tag LOCUS_16910 96392 97501 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258677.1 protein_id gnl|my_center|LOCUS_16910 97860 97645 gene locus_tag LOCUS_16920 97860 97645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 97855 99198 gene locus_tag LOCUS_16930 gene mgtE 97855 99198 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_16930 101245 99392 gene locus_tag LOCUS_16940 101245 99392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 102002 101235 gene locus_tag LOCUS_16950 102002 101235 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986651.1 protein_id gnl|my_center|LOCUS_16950 102458 104044 gene locus_tag LOCUS_16960 102458 104044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 104182 104808 gene locus_tag LOCUS_16970 104182 104808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 104865 106577 gene locus_tag LOCUS_16980 104865 106577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 106665 107783 gene locus_tag LOCUS_16990 106665 107783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 107780 108919 gene locus_tag LOCUS_17000 107780 108919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 109376 109101 gene locus_tag LOCUS_17010 109376 109101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 110556 109471 gene locus_tag LOCUS_17020 110556 109471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 111297 110692 gene locus_tag LOCUS_17030 111297 110692 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023352.1 protein_id gnl|my_center|LOCUS_17030 112819 111443 gene locus_tag LOCUS_17040 112819 111443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 112999 114051 gene locus_tag LOCUS_17050 gene spoIID 112999 114051 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393851.1 protein_id gnl|my_center|LOCUS_17050 114907 114056 gene locus_tag LOCUS_17060 114907 114056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 115314 115051 gene locus_tag LOCUS_17070 gene rpsT 115314 115051 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 protein_id gnl|my_center|LOCUS_17070 115514 116404 gene locus_tag LOCUS_17080 gene gpr 115514 116404 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460511.1 protein_id gnl|my_center|LOCUS_17080 118263 116455 gene locus_tag LOCUS_17090 gene lepA 118263 116455 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357725.1 protein_id gnl|my_center|LOCUS_17090 118793 118401 gene locus_tag LOCUS_17100 118793 118401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 119142 118696 gene locus_tag LOCUS_17110 119142 118696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 119872 119156 gene locus_tag LOCUS_17120 119872 119156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 120092 121066 gene locus_tag LOCUS_17130 gene pta 120092 121066 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067221.1 protein_id gnl|my_center|LOCUS_17130 122511 121108 gene locus_tag LOCUS_17140 gene mnmE 122511 121108 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258674.1 protein_id gnl|my_center|LOCUS_17140 124601 123006 gene locus_tag LOCUS_17150 124601 123006 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986363.1 protein_id gnl|my_center|LOCUS_17150 125169 124906 gene locus_tag LOCUS_17160 125169 124906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 125371 125162 gene locus_tag LOCUS_17170 125371 125162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 126479 125655 gene locus_tag LOCUS_17180 126479 125655 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039292.1 protein_id gnl|my_center|LOCUS_17180 128143 126476 gene locus_tag LOCUS_17190 128143 126476 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_17190 128783 128124 gene locus_tag LOCUS_17200 128783 128124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 130386 128851 gene locus_tag LOCUS_17210 gene guaA 130386 128851 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679432.1 protein_id gnl|my_center|LOCUS_17210 132163 130583 gene locus_tag LOCUS_17220 gene asnB 132163 130583 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905297.1 protein_id gnl|my_center|LOCUS_17220 134370 132274 gene locus_tag LOCUS_17230 134370 132274 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_17230 134695 135906 gene locus_tag LOCUS_17240 gene glnA 134695 135906 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807771.1 protein_id gnl|my_center|LOCUS_17240 135931 136515 gene locus_tag LOCUS_17250 135931 136515 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807769.1 protein_id gnl|my_center|LOCUS_17250 137463 136561 gene locus_tag LOCUS_17260 137463 136561 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460597.1 protein_id gnl|my_center|LOCUS_17260 138286 137474 gene locus_tag LOCUS_17270 138286 137474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 139193 138279 gene locus_tag LOCUS_17280 139193 138279 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004846624.1 protein_id gnl|my_center|LOCUS_17280 139946 139284 gene locus_tag LOCUS_17290 139946 139284 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202796158.1 protein_id gnl|my_center|LOCUS_17290 140067 141248 gene locus_tag LOCUS_17300 140067 141248 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080839.1 protein_id gnl|my_center|LOCUS_17300 142569 141289 gene locus_tag LOCUS_17310 142569 141289 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_17310 142695 143561 gene locus_tag LOCUS_17320 142695 143561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 143752 145131 gene locus_tag LOCUS_17330 143752 145131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 145642 145196 gene locus_tag LOCUS_17340 145642 145196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 147343 145655 gene locus_tag LOCUS_17350 147343 145655 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036677.1 protein_id gnl|my_center|LOCUS_17350 147718 147371 gene locus_tag LOCUS_17360 147718 147371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 147915 148313 gene locus_tag LOCUS_17370 147915 148313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461799.1 protein_id gnl|my_center|LOCUS_17370 148475 150568 gene locus_tag LOCUS_17380 148475 150568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 150627 150770 gene locus_tag LOCUS_17390 150627 150770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 >Feature sequence008 1303 1016 gene locus_tag LOCUS_17400 1303 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 3178 1847 gene locus_tag LOCUS_17410 3178 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 3854 3171 gene locus_tag LOCUS_17420 3854 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 6013 4667 gene locus_tag LOCUS_17430 6013 4667 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876596.1 protein_id gnl|my_center|LOCUS_17430 7569 6094 gene locus_tag LOCUS_17440 7569 6094 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868031.1 protein_id gnl|my_center|LOCUS_17440 8846 7692 gene locus_tag LOCUS_17450 8846 7692 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723307.1 protein_id gnl|my_center|LOCUS_17450 9506 8883 gene locus_tag LOCUS_17460 9506 8883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 10778 9540 gene locus_tag LOCUS_17470 10778 9540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 10929 11831 gene locus_tag LOCUS_17480 10929 11831 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948703.1 protein_id gnl|my_center|LOCUS_17480 12573 13730 gene locus_tag LOCUS_17490 12573 13730 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_17490 13928 13853 gene locus_tag LOCUS_t00360 13928 13853 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 14112 14026 gene locus_tag LOCUS_t00370 14112 14026 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14456 14854 gene locus_tag LOCUS_17500 14456 14854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 14856 15053 gene locus_tag LOCUS_17510 14856 15053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 15267 16331 gene locus_tag LOCUS_17520 15267 16331 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861248.1 protein_id gnl|my_center|LOCUS_17520 16338 16970 gene locus_tag LOCUS_17530 gene hisG 16338 16970 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436683.1 protein_id gnl|my_center|LOCUS_17530 16967 18043 gene locus_tag LOCUS_17540 gene hisC 16967 18043 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063930.1 protein_id gnl|my_center|LOCUS_17540 18036 18623 gene locus_tag LOCUS_17550 gene hisB 18036 18623 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566359.1 protein_id gnl|my_center|LOCUS_17550 18623 19240 gene locus_tag LOCUS_17560 gene hisH 18623 19240 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964257.1 protein_id gnl|my_center|LOCUS_17560 19254 19973 gene locus_tag LOCUS_17570 gene hisA 19254 19973 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263872.1 protein_id gnl|my_center|LOCUS_17570 19970 20728 gene locus_tag LOCUS_17580 gene hisF 19970 20728 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263180.1 protein_id gnl|my_center|LOCUS_17580 20896 21543 gene locus_tag LOCUS_17590 gene hisIE 20896 21543 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243045.1 protein_id gnl|my_center|LOCUS_17590 21540 22349 gene locus_tag LOCUS_17600 21540 22349 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_17600 22502 23128 gene locus_tag LOCUS_17610 22502 23128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 23125 24486 gene locus_tag LOCUS_17620 23125 24486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 24500 25690 gene locus_tag LOCUS_17630 24500 25690 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214669.1 protein_id gnl|my_center|LOCUS_17630 25696 28818 gene locus_tag LOCUS_17640 25696 28818 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461050.1 protein_id gnl|my_center|LOCUS_17640 29079 28858 gene locus_tag LOCUS_17650 29079 28858 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459149.1 protein_id gnl|my_center|LOCUS_17650 29280 29771 gene locus_tag LOCUS_17660 29280 29771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 30733 29810 gene locus_tag LOCUS_17670 30733 29810 CDS product HTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679309.1 protein_id gnl|my_center|LOCUS_17670 32680 30755 gene locus_tag LOCUS_17680 32680 30755 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107164.1 protein_id gnl|my_center|LOCUS_17680 32901 33392 gene locus_tag LOCUS_17690 32901 33392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 38431 33593 gene locus_tag LOCUS_17700 38431 33593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 39221 39457 gene locus_tag LOCUS_17710 39221 39457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17710 39432 39797 gene locus_tag LOCUS_17720 39432 39797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17720 40005 41189 gene locus_tag LOCUS_17730 gene metK 40005 41189 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966140.1 protein_id gnl|my_center|LOCUS_17730 41349 41990 gene locus_tag LOCUS_17740 gene deoC 41349 41990 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439345.1 protein_id gnl|my_center|LOCUS_17740 43601 42087 gene locus_tag LOCUS_17750 43601 42087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 43707 43949 gene locus_tag LOCUS_17760 43707 43949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 44353 44036 gene locus_tag LOCUS_17770 44353 44036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 44640 47369 gene locus_tag LOCUS_17780 44640 47369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 47592 48032 gene locus_tag LOCUS_17790 47592 48032 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811150.1 protein_id gnl|my_center|LOCUS_17790 48222 49433 gene locus_tag LOCUS_17800 48222 49433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 49626 50849 gene locus_tag LOCUS_17810 49626 50849 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_17810 51090 50887 gene locus_tag LOCUS_17820 51090 50887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 51195 51962 gene locus_tag LOCUS_17830 51195 51962 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947941.1 protein_id gnl|my_center|LOCUS_17830 52054 52536 gene locus_tag LOCUS_17840 52054 52536 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905253.1 protein_id gnl|my_center|LOCUS_17840 52603 53223 gene locus_tag LOCUS_17850 52603 53223 CDS product TIGR04100 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860776.1 protein_id gnl|my_center|LOCUS_17850 53364 53714 gene locus_tag LOCUS_17860 53364 53714 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_17860 54866 53754 gene locus_tag LOCUS_17870 54866 53754 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200023.1 protein_id gnl|my_center|LOCUS_17870 55730 54924 gene locus_tag LOCUS_17880 55730 54924 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425096.1 protein_id gnl|my_center|LOCUS_17880 56254 55769 gene locus_tag LOCUS_17890 56254 55769 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963446.1 protein_id gnl|my_center|LOCUS_17890 58366 56285 gene locus_tag LOCUS_17900 58366 56285 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860851.1 protein_id gnl|my_center|LOCUS_17900 58622 60058 gene locus_tag LOCUS_17910 58622 60058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 60045 60377 gene locus_tag LOCUS_17920 60045 60377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 60393 60977 gene locus_tag LOCUS_17930 60393 60977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 61046 66775 gene locus_tag LOCUS_17940 61046 66775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 66844 70998 gene locus_tag LOCUS_17950 66844 70998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 73195 71042 gene locus_tag LOCUS_17960 73195 71042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 74155 73370 gene locus_tag LOCUS_17970 gene rlmB 74155 73370 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357423.1 protein_id gnl|my_center|LOCUS_17970 74371 76503 gene locus_tag LOCUS_17980 gene ftsH 74371 76503 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048280.1 protein_id gnl|my_center|LOCUS_17980 76666 76541 gene locus_tag LOCUS_17990 76666 76541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 77375 76797 gene locus_tag LOCUS_18000 77375 76797 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392579.1 protein_id gnl|my_center|LOCUS_18000 77960 77448 gene locus_tag LOCUS_18010 77960 77448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 78465 77971 gene locus_tag LOCUS_18020 78465 77971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 78931 78560 gene locus_tag LOCUS_18030 78931 78560 CDS product DUF3846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272736.1 protein_id gnl|my_center|LOCUS_18030 79742 78954 gene locus_tag LOCUS_18040 79742 78954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 80700 79756 gene locus_tag LOCUS_18050 80700 79756 CDS product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398673.1 protein_id gnl|my_center|LOCUS_18050 81651 80716 gene locus_tag LOCUS_18060 81651 80716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 83337 81790 gene locus_tag LOCUS_18070 83337 81790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 85077 83350 gene locus_tag LOCUS_18080 85077 83350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 86675 85074 gene locus_tag LOCUS_18090 86675 85074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 86851 86696 gene locus_tag LOCUS_18100 86851 86696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 87071 86856 gene locus_tag LOCUS_18110 87071 86856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 87725 87162 gene locus_tag LOCUS_18120 87725 87162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 87886 89274 gene locus_tag LOCUS_18130 87886 89274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 89599 89264 gene locus_tag LOCUS_18140 89599 89264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 92247 89986 gene locus_tag LOCUS_18150 92247 89986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 92827 92345 gene locus_tag LOCUS_18160 92827 92345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 93846 92905 gene locus_tag LOCUS_18170 93846 92905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 95501 93903 gene locus_tag LOCUS_18180 95501 93903 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301254.1 protein_id gnl|my_center|LOCUS_18180 97076 97246 gene locus_tag LOCUS_18190 97076 97246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 97685 97284 gene locus_tag LOCUS_18200 97685 97284 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052491.1 protein_id gnl|my_center|LOCUS_18200 97968 97672 gene locus_tag LOCUS_18210 97968 97672 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052490.1 protein_id gnl|my_center|LOCUS_18210 98463 98038 gene locus_tag LOCUS_18220 98463 98038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 99704 98772 gene locus_tag LOCUS_18230 99704 98772 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795892.1 protein_id gnl|my_center|LOCUS_18230 100050 99712 gene locus_tag LOCUS_18240 100050 99712 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964599.1 protein_id gnl|my_center|LOCUS_18240 100358 100597 gene locus_tag LOCUS_18250 100358 100597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 101774 100713 gene locus_tag LOCUS_18260 gene pyrB 101774 100713 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_18260 101986 102513 gene locus_tag LOCUS_18270 101986 102513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 102725 102555 gene locus_tag LOCUS_18280 102725 102555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 103516 102803 gene locus_tag LOCUS_18290 103516 102803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 103804 103574 gene locus_tag LOCUS_18300 103804 103574 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459191.1 protein_id gnl|my_center|LOCUS_18300 104203 103823 gene locus_tag LOCUS_18310 104203 103823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 104636 104298 gene locus_tag LOCUS_18320 104636 104298 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460091.1 protein_id gnl|my_center|LOCUS_18320 104886 104626 gene locus_tag LOCUS_18330 104886 104626 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812819.1 protein_id gnl|my_center|LOCUS_18330 105286 104963 gene locus_tag LOCUS_18340 105286 104963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 105912 105577 gene locus_tag LOCUS_18350 105912 105577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 106428 105997 gene locus_tag LOCUS_18360 106428 105997 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_18360 107743 106442 gene locus_tag LOCUS_18370 107743 106442 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931806.1 protein_id gnl|my_center|LOCUS_18370 108244 107858 gene locus_tag LOCUS_18380 108244 107858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 108841 108269 gene locus_tag LOCUS_18390 108841 108269 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965300.1 protein_id gnl|my_center|LOCUS_18390 110602 108845 gene locus_tag LOCUS_18400 gene iorA 110602 108845 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_18400 111049 110744 gene locus_tag LOCUS_18410 111049 110744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 111435 113069 gene locus_tag LOCUS_18420 111435 113069 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086603.1 protein_id gnl|my_center|LOCUS_18420 113396 113791 gene locus_tag LOCUS_18430 113396 113791 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812484.1 protein_id gnl|my_center|LOCUS_18430 113788 114981 gene locus_tag LOCUS_18440 113788 114981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 115587 115018 gene locus_tag LOCUS_18450 115587 115018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 116639 115584 gene locus_tag LOCUS_18460 116639 115584 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940117.1 protein_id gnl|my_center|LOCUS_18460 117010 116636 gene locus_tag LOCUS_18470 117010 116636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 117466 117023 gene locus_tag LOCUS_18480 117466 117023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 118488 117538 gene locus_tag LOCUS_18490 118488 117538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 119060 118485 gene locus_tag LOCUS_18500 119060 118485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 119764 119075 gene locus_tag LOCUS_18510 119764 119075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 119975 119757 gene locus_tag LOCUS_18520 119975 119757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 120397 120014 gene locus_tag LOCUS_18530 120397 120014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 120790 120401 gene locus_tag LOCUS_18540 120790 120401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 121861 120803 gene locus_tag LOCUS_18550 121861 120803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 122361 121858 gene locus_tag LOCUS_18560 122361 121858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 122678 122358 gene locus_tag LOCUS_18570 122678 122358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 123043 122678 gene locus_tag LOCUS_18580 123043 122678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 124055 123045 gene locus_tag LOCUS_18590 124055 123045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 125018 124122 gene locus_tag LOCUS_18600 125018 124122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 126151 125015 gene locus_tag LOCUS_18610 126151 125015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 127585 126335 gene locus_tag LOCUS_18620 127585 126335 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_18620 127886 127587 gene locus_tag LOCUS_18630 127886 127587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 128194 129345 gene locus_tag LOCUS_18640 128194 129345 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428267.1 protein_id gnl|my_center|LOCUS_18640 129667 131706 gene locus_tag LOCUS_18650 gene glgB 129667 131706 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_18650 131881 133092 gene locus_tag LOCUS_18660 131881 133092 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965535.1 protein_id gnl|my_center|LOCUS_18660 133089 134204 gene locus_tag LOCUS_18670 gene glgD 133089 134204 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183792.1 protein_id gnl|my_center|LOCUS_18670 134314 135789 gene locus_tag LOCUS_18680 gene glgA 134314 135789 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697284.1 protein_id gnl|my_center|LOCUS_18680 135979 138426 gene locus_tag LOCUS_18690 135979 138426 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081712308.1 protein_id gnl|my_center|LOCUS_18690 138695 138552 gene locus_tag LOCUS_18700 138695 138552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 139568 139131 gene locus_tag LOCUS_18710 139568 139131 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421494.1 protein_id gnl|my_center|LOCUS_18710 140824 139568 gene locus_tag LOCUS_18720 gene hutI 140824 139568 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673322.1 protein_id gnl|my_center|LOCUS_18720 142875 140860 gene locus_tag LOCUS_18730 142875 140860 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765435.1 protein_id gnl|my_center|LOCUS_18730 >Feature sequence009 224 520 gene locus_tag LOCUS_18740 gene rpsF 224 520 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048444.1 protein_id gnl|my_center|LOCUS_18740 533 1018 gene locus_tag LOCUS_18750 533 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 1057 1302 gene locus_tag LOCUS_18760 gene rpsR 1057 1302 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391678.1 protein_id gnl|my_center|LOCUS_18760 1679 1470 gene locus_tag LOCUS_18770 1679 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 2680 1676 gene locus_tag LOCUS_18780 2680 1676 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519082.1 protein_id gnl|my_center|LOCUS_18780 3635 2682 gene locus_tag LOCUS_18790 3635 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 4271 3735 gene locus_tag LOCUS_18800 4271 3735 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389733.1 protein_id gnl|my_center|LOCUS_18800 4828 5769 gene locus_tag LOCUS_18810 4828 5769 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707531.1 protein_id gnl|my_center|LOCUS_18810 5899 7056 gene locus_tag LOCUS_18820 5899 7056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 8319 7198 gene locus_tag LOCUS_18830 gene prfB 8319 7198 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191976281.1 protein_id gnl|my_center|LOCUS_18830 8459 8755 gene locus_tag LOCUS_18840 8459 8755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 8759 9190 gene locus_tag LOCUS_18850 8759 9190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 11229 9376 gene locus_tag LOCUS_18860 11229 9376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 12683 11433 gene locus_tag LOCUS_18870 12683 11433 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931069.1 protein_id gnl|my_center|LOCUS_18870 13417 12680 gene locus_tag LOCUS_18880 13417 12680 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722723.1 protein_id gnl|my_center|LOCUS_18880 15080 13431 gene locus_tag LOCUS_18890 15080 13431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 15420 15764 gene locus_tag LOCUS_18900 15420 15764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 17016 15856 gene locus_tag LOCUS_18910 17016 15856 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861528.1 protein_id gnl|my_center|LOCUS_18910 17435 18178 gene locus_tag LOCUS_18920 17435 18178 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002323503.1 protein_id gnl|my_center|LOCUS_18920 18227 20128 gene locus_tag LOCUS_18930 gene mtlA 18227 20128 CDS product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093271.1 protein_id gnl|my_center|LOCUS_18930 20432 20295 gene locus_tag LOCUS_18940 20432 20295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 20542 22287 gene locus_tag LOCUS_18950 20542 22287 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_18950 22487 23161 gene locus_tag LOCUS_18960 22487 23161 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_18960 23158 24840 gene locus_tag LOCUS_18970 23158 24840 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_18970 25230 25003 gene locus_tag LOCUS_18980 25230 25003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 25144 26619 gene locus_tag LOCUS_18990 25144 26619 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463798.1 protein_id gnl|my_center|LOCUS_18990 28073 26706 gene locus_tag LOCUS_19000 28073 26706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 28623 29351 gene locus_tag LOCUS_19010 28623 29351 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965675.1 protein_id gnl|my_center|LOCUS_19010 29480 29806 gene locus_tag LOCUS_19020 29480 29806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 29803 30924 gene locus_tag LOCUS_19030 29803 30924 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869718.1 protein_id gnl|my_center|LOCUS_19030 30924 31448 gene locus_tag LOCUS_19040 30924 31448 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869717.1 protein_id gnl|my_center|LOCUS_19040 31454 31726 gene locus_tag LOCUS_19050 31454 31726 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249076.1 protein_id gnl|my_center|LOCUS_19050 31719 32873 gene locus_tag LOCUS_19060 31719 32873 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215235.1 protein_id gnl|my_center|LOCUS_19060 32886 34013 gene locus_tag LOCUS_19070 32886 34013 CDS product muconate cycloisomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113308.1 protein_id gnl|my_center|LOCUS_19070 34104 35513 gene locus_tag LOCUS_19080 34104 35513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 35565 35978 gene locus_tag LOCUS_19090 35565 35978 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272025.1 protein_id gnl|my_center|LOCUS_19090 36196 37671 gene locus_tag LOCUS_19100 36196 37671 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878569.1 protein_id gnl|my_center|LOCUS_19100 37643 39298 gene locus_tag LOCUS_19110 37643 39298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 39288 40679 gene locus_tag LOCUS_19120 39288 40679 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943160.1 protein_id gnl|my_center|LOCUS_19120 40871 41638 gene locus_tag LOCUS_19130 40871 41638 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896287.1 protein_id gnl|my_center|LOCUS_19130 41675 42925 gene locus_tag LOCUS_19140 41675 42925 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419704.1 protein_id gnl|my_center|LOCUS_19140 42997 43737 gene locus_tag LOCUS_19150 gene pxpB 42997 43737 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889166.1 protein_id gnl|my_center|LOCUS_19150 43734 44675 gene locus_tag LOCUS_19160 43734 44675 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896290.1 protein_id gnl|my_center|LOCUS_19160 44726 45550 gene locus_tag LOCUS_19170 44726 45550 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886407.1 protein_id gnl|my_center|LOCUS_19170 45689 46699 gene locus_tag LOCUS_19180 45689 46699 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582593.1 protein_id gnl|my_center|LOCUS_19180 46776 48119 gene locus_tag LOCUS_19190 46776 48119 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964165.1 protein_id gnl|my_center|LOCUS_19190 48208 49410 gene locus_tag LOCUS_19200 48208 49410 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119310.1 protein_id gnl|my_center|LOCUS_19200 49439 50293 gene locus_tag LOCUS_19210 49439 50293 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261394.1 protein_id gnl|my_center|LOCUS_19210 50304 50951 gene locus_tag LOCUS_19220 50304 50951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 51431 52804 gene locus_tag LOCUS_19230 51431 52804 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672105.1 protein_id gnl|my_center|LOCUS_19230 52939 53856 gene locus_tag LOCUS_19240 52939 53856 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003052879.1 protein_id gnl|my_center|LOCUS_19240 53869 54795 gene locus_tag LOCUS_19250 53869 54795 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192007.1 protein_id gnl|my_center|LOCUS_19250 54831 55742 gene locus_tag LOCUS_19260 54831 55742 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281520.1 protein_id gnl|my_center|LOCUS_19260 56401 55808 gene locus_tag LOCUS_19270 56401 55808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 58836 56419 gene locus_tag LOCUS_19280 58836 56419 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775403.1 protein_id gnl|my_center|LOCUS_19280 61913 58926 gene locus_tag LOCUS_19290 61913 58926 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_19290 63425 62094 gene locus_tag LOCUS_19300 63425 62094 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775459.1 protein_id gnl|my_center|LOCUS_19300 64132 63422 gene locus_tag LOCUS_19310 64132 63422 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813911.1 protein_id gnl|my_center|LOCUS_19310 66753 64618 gene locus_tag LOCUS_19320 gene ptsG 66753 64618 CDS product glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948935.1 protein_id gnl|my_center|LOCUS_19320 67712 66870 gene locus_tag LOCUS_19330 gene licT 67712 66870 CDS product transcriptional antiterminator LicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242598.1 protein_id gnl|my_center|LOCUS_19330 68561 69877 gene locus_tag LOCUS_19340 68561 69877 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583013.1 protein_id gnl|my_center|LOCUS_19340 70100 71005 gene locus_tag LOCUS_19350 70100 71005 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112931.1 protein_id gnl|my_center|LOCUS_19350 71005 71862 gene locus_tag LOCUS_19360 71005 71862 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068636.1 protein_id gnl|my_center|LOCUS_19360 72077 73084 gene locus_tag LOCUS_19370 72077 73084 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_19370 73192 74691 gene locus_tag LOCUS_19380 gene malQ 73192 74691 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_19380 74708 76000 gene locus_tag LOCUS_19390 74708 76000 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641774.1 protein_id gnl|my_center|LOCUS_19390 76456 76085 gene locus_tag LOCUS_19400 76456 76085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 76774 77583 gene locus_tag LOCUS_19410 76774 77583 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_19410 78868 77591 gene locus_tag LOCUS_19420 78868 77591 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 protein_id gnl|my_center|LOCUS_19420 80385 79375 gene locus_tag LOCUS_19430 gene gap 80385 79375 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759940.1 protein_id gnl|my_center|LOCUS_19430 80714 81769 gene locus_tag LOCUS_19440 80714 81769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 82080 81835 gene locus_tag LOCUS_19450 82080 81835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 83489 82509 gene locus_tag LOCUS_19460 83489 82509 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_19460 84910 83486 gene locus_tag LOCUS_19470 84910 83486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 86532 84907 gene locus_tag LOCUS_19480 86532 84907 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288004.1 protein_id gnl|my_center|LOCUS_19480 87415 86645 gene locus_tag LOCUS_19490 87415 86645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816588.1 protein_id gnl|my_center|LOCUS_19490 88143 87415 gene locus_tag LOCUS_19500 88143 87415 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816590.1 protein_id gnl|my_center|LOCUS_19500 88499 88140 gene locus_tag LOCUS_19510 88499 88140 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816592.1 protein_id gnl|my_center|LOCUS_19510 88683 89813 gene locus_tag LOCUS_19520 gene glf 88683 89813 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228271.1 protein_id gnl|my_center|LOCUS_19520 89929 90957 gene locus_tag LOCUS_19530 89929 90957 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964797.1 protein_id gnl|my_center|LOCUS_19530 90981 92606 gene locus_tag LOCUS_19540 90981 92606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 92624 93874 gene locus_tag LOCUS_19550 92624 93874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 94356 94670 gene locus_tag LOCUS_19560 gene rpsJ 94356 94670 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118667.1 protein_id gnl|my_center|LOCUS_19560 94909 95637 gene locus_tag LOCUS_19570 gene rplC 94909 95637 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_19570 95657 96277 gene locus_tag LOCUS_19580 gene rplD 95657 96277 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357518.1 protein_id gnl|my_center|LOCUS_19580 96277 96576 gene locus_tag LOCUS_19590 gene rplW 96277 96576 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966410.1 protein_id gnl|my_center|LOCUS_19590 96591 97424 gene locus_tag LOCUS_19600 gene rplB 96591 97424 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966409.1 protein_id gnl|my_center|LOCUS_19600 97441 97713 gene locus_tag LOCUS_19610 gene rpsS 97441 97713 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_19610 97729 98061 gene locus_tag LOCUS_19620 gene rplV 97729 98061 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966407.1 protein_id gnl|my_center|LOCUS_19620 98077 98940 gene locus_tag LOCUS_19630 gene rpsC 98077 98940 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421163.1 protein_id gnl|my_center|LOCUS_19630 98940 99371 gene locus_tag LOCUS_19640 gene rplP 98940 99371 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_19640 99371 99568 gene locus_tag LOCUS_19650 gene rpmC 99371 99568 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393929.1 protein_id gnl|my_center|LOCUS_19650 99584 99844 gene locus_tag LOCUS_19660 gene rpsQ 99584 99844 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_19660 99860 100228 gene locus_tag LOCUS_19670 gene rplN 99860 100228 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357295.1 protein_id gnl|my_center|LOCUS_19670 100242 100559 gene locus_tag LOCUS_19680 gene rplX 100242 100559 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583356.1 protein_id gnl|my_center|LOCUS_19680 100580 101140 gene locus_tag LOCUS_19690 gene rplE 100580 101140 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966400.1 protein_id gnl|my_center|LOCUS_19690 101155 101340 gene locus_tag LOCUS_19700 101155 101340 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459104.1 protein_id gnl|my_center|LOCUS_19700 101896 102294 gene locus_tag LOCUS_19710 gene rpsH 101896 102294 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_19710 102310 102855 gene locus_tag LOCUS_19720 gene rplF 102310 102855 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393922.1 protein_id gnl|my_center|LOCUS_19720 102874 103233 gene locus_tag LOCUS_19730 gene rplR 102874 103233 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628816.1 protein_id gnl|my_center|LOCUS_19730 103251 103751 gene locus_tag LOCUS_19740 gene rpsE 103251 103751 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_19740 103764 103946 gene locus_tag LOCUS_19750 gene rpmD 103764 103946 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814541.1 protein_id gnl|my_center|LOCUS_19750 103964 104404 gene locus_tag LOCUS_19760 gene rplO 103964 104404 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966393.1 protein_id gnl|my_center|LOCUS_19760 104407 105801 gene locus_tag LOCUS_19770 gene secY 104407 105801 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810127.1 protein_id gnl|my_center|LOCUS_19770 105814 106452 gene locus_tag LOCUS_19780 105814 106452 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943465.1 protein_id gnl|my_center|LOCUS_19780 106452 107228 gene locus_tag LOCUS_19790 gene map 106452 107228 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421130.1 protein_id gnl|my_center|LOCUS_19790 107221 107538 gene locus_tag LOCUS_19800 107221 107538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 107531 107749 gene locus_tag LOCUS_19810 gene infA 107531 107749 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_19810 107960 108325 gene locus_tag LOCUS_19820 gene rpsM 107960 108325 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966388.1 protein_id gnl|my_center|LOCUS_19820 108338 108736 gene locus_tag LOCUS_19830 gene rpsK 108338 108736 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401717.1 protein_id gnl|my_center|LOCUS_19830 108760 109362 gene locus_tag LOCUS_19840 gene rpsD 108760 109362 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_19840 109583 110533 gene locus_tag LOCUS_19850 109583 110533 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810110.1 protein_id gnl|my_center|LOCUS_19850 110627 110971 gene locus_tag LOCUS_19860 gene rplQ 110627 110971 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966384.1 protein_id gnl|my_center|LOCUS_19860 111323 112624 gene locus_tag LOCUS_19870 gene galK 111323 112624 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_19870 112762 114258 gene locus_tag LOCUS_19880 gene galT 112762 114258 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_19880 115112 114414 gene locus_tag LOCUS_19890 gene araD 115112 114414 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094947.1 protein_id gnl|my_center|LOCUS_19890 116675 115212 gene locus_tag LOCUS_19900 gene araA 116675 115212 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229499.1 protein_id gnl|my_center|LOCUS_19900 118339 116813 gene locus_tag LOCUS_19910 118339 116813 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_19910 119399 118353 gene locus_tag LOCUS_19920 gene yjfF 119399 118353 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226243.1 protein_id gnl|my_center|LOCUS_19920 120510 119401 gene locus_tag LOCUS_19930 120510 119401 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226242.1 protein_id gnl|my_center|LOCUS_19930 122024 120507 gene locus_tag LOCUS_19940 122024 120507 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467107.1 protein_id gnl|my_center|LOCUS_19940 123170 122124 gene locus_tag LOCUS_19950 123170 122124 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_19950 123716 124795 gene locus_tag LOCUS_19960 gene araR 123716 124795 CDS product arabinose utilization transcriptional regulator AraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243070.1 protein_id gnl|my_center|LOCUS_19960 126350 124821 gene locus_tag LOCUS_19970 126350 124821 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054550.1 protein_id gnl|my_center|LOCUS_19970 127145 126522 gene locus_tag LOCUS_19980 127145 126522 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965893.1 protein_id gnl|my_center|LOCUS_19980 127860 127153 gene locus_tag LOCUS_19990 127860 127153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 127979 128647 gene locus_tag LOCUS_20000 127979 128647 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944392.1 protein_id gnl|my_center|LOCUS_20000 128728 129303 gene locus_tag LOCUS_20010 gene yfbR 128728 129303 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158196.1 protein_id gnl|my_center|LOCUS_20010 129487 129756 gene locus_tag LOCUS_20020 129487 129756 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963800.1 protein_id gnl|my_center|LOCUS_20020 129769 131127 gene locus_tag LOCUS_20030 129769 131127 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861617.1 protein_id gnl|my_center|LOCUS_20030 >Feature sequence010 194 1102 gene locus_tag LOCUS_20040 194 1102 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965690.1 protein_id gnl|my_center|LOCUS_20040 1225 2136 gene locus_tag LOCUS_20050 gene ftcD 1225 2136 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922735.1 protein_id gnl|my_center|LOCUS_20050 2149 2775 gene locus_tag LOCUS_20060 2149 2775 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922736.1 protein_id gnl|my_center|LOCUS_20060 2978 3544 gene locus_tag LOCUS_20070 2978 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 3561 4139 gene locus_tag LOCUS_20080 3561 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 4144 5409 gene locus_tag LOCUS_20090 4144 5409 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_20090 5435 6241 gene locus_tag LOCUS_20100 5435 6241 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272216.1 protein_id gnl|my_center|LOCUS_20100 6567 6355 gene locus_tag LOCUS_20110 6567 6355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 6711 7610 gene locus_tag LOCUS_20120 6711 7610 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245785.1 protein_id gnl|my_center|LOCUS_20120 7774 8709 gene locus_tag LOCUS_20130 7774 8709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 8706 9167 gene locus_tag LOCUS_20140 8706 9167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 10107 9199 gene locus_tag LOCUS_20150 10107 9199 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054703570.1 protein_id gnl|my_center|LOCUS_20150 11232 10123 gene locus_tag LOCUS_20160 11232 10123 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062822309.1 protein_id gnl|my_center|LOCUS_20160 13026 11266 gene locus_tag LOCUS_20170 gene thrS 13026 11266 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048136.1 protein_id gnl|my_center|LOCUS_20170 13233 13084 gene locus_tag LOCUS_20180 13233 13084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 13647 14318 gene locus_tag LOCUS_20190 gene pyrE 13647 14318 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_20190 14332 14808 gene locus_tag LOCUS_20200 14332 14808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 14844 15572 gene locus_tag LOCUS_20210 gene radC 14844 15572 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338763.1 protein_id gnl|my_center|LOCUS_20210 15672 17636 gene locus_tag LOCUS_20220 gene uvrB 15672 17636 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_20220 17649 17963 gene locus_tag LOCUS_20230 17649 17963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 17968 18621 gene locus_tag LOCUS_20240 17968 18621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 18798 19043 gene locus_tag LOCUS_20250 18798 19043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 19027 19347 gene locus_tag LOCUS_20260 19027 19347 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948666.1 protein_id gnl|my_center|LOCUS_20260 19372 19737 gene locus_tag LOCUS_20270 19372 19737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 19773 22598 gene locus_tag LOCUS_20280 gene uvrA 19773 22598 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401468.1 protein_id gnl|my_center|LOCUS_20280 22864 22634 gene locus_tag LOCUS_20290 22864 22634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 22946 23158 gene locus_tag LOCUS_20300 22946 23158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 23163 23660 gene locus_tag LOCUS_20310 23163 23660 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106578.1 protein_id gnl|my_center|LOCUS_20310 23737 24069 gene locus_tag LOCUS_20320 23737 24069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 24203 26401 gene locus_tag LOCUS_20330 24203 26401 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_20330 27249 26587 gene locus_tag LOCUS_20340 27249 26587 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390012.1 protein_id gnl|my_center|LOCUS_20340 27352 27747 gene locus_tag LOCUS_20350 gene cdd 27352 27747 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080780.1 protein_id gnl|my_center|LOCUS_20350 27823 28035 gene locus_tag LOCUS_20360 27823 28035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 29095 28097 gene locus_tag LOCUS_20370 gene lplA2 29095 28097 CDS product lipoate protein ligase LplA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721881.1 protein_id gnl|my_center|LOCUS_20370 29313 30092 gene locus_tag LOCUS_20380 gene rhaR 29313 30092 CDS product rhamnose catabolism operon transcriptional regulator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968057.1 protein_id gnl|my_center|LOCUS_20380 30130 31386 gene locus_tag LOCUS_20390 gene acoC 30130 31386 CDS product acetoin dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244059.1 protein_id gnl|my_center|LOCUS_20390 31399 32766 gene locus_tag LOCUS_20400 gene lpdA 31399 32766 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766155.1 protein_id gnl|my_center|LOCUS_20400 32788 35262 gene locus_tag LOCUS_20410 32788 35262 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582808.1 protein_id gnl|my_center|LOCUS_20410 35255 35926 gene locus_tag LOCUS_20420 35255 35926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 36384 36133 gene locus_tag LOCUS_20430 36384 36133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20430 36872 36456 gene locus_tag LOCUS_20440 36872 36456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20440 37710 37150 gene locus_tag LOCUS_20450 37710 37150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 37946 37707 gene locus_tag LOCUS_20460 37946 37707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 40016 38067 gene locus_tag LOCUS_20470 40016 38067 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575935.1 protein_id gnl|my_center|LOCUS_20470 40497 40102 gene locus_tag LOCUS_20480 gene nifU 40497 40102 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391905.1 protein_id gnl|my_center|LOCUS_20480 41697 40513 gene locus_tag LOCUS_20490 gene nifS 41697 40513 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 protein_id gnl|my_center|LOCUS_20490 43066 41903 gene locus_tag LOCUS_20500 43066 41903 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383734.1 protein_id gnl|my_center|LOCUS_20500 44118 43234 gene locus_tag LOCUS_20510 44118 43234 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383735.1 protein_id gnl|my_center|LOCUS_20510 44868 44188 gene locus_tag LOCUS_20520 44868 44188 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009571.1 protein_id gnl|my_center|LOCUS_20520 45895 44861 gene locus_tag LOCUS_20530 gene metN 45895 44861 CDS product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648552.1 protein_id gnl|my_center|LOCUS_20530 46890 45991 gene locus_tag LOCUS_20540 46890 45991 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052232.1 protein_id gnl|my_center|LOCUS_20540 48340 46904 gene locus_tag LOCUS_20550 48340 46904 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_20550 49725 48337 gene locus_tag LOCUS_20560 gene trkA 49725 48337 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_20560 50594 49881 gene locus_tag LOCUS_20570 50594 49881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 50772 52013 gene locus_tag LOCUS_20580 50772 52013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 52263 53597 gene locus_tag LOCUS_20590 52263 53597 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461201.1 protein_id gnl|my_center|LOCUS_20590 54015 55184 gene locus_tag LOCUS_20600 54015 55184 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_20600 55174 56010 gene locus_tag LOCUS_20610 55174 56010 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432157.1 protein_id gnl|my_center|LOCUS_20610 56007 58010 gene locus_tag LOCUS_20620 56007 58010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 58328 59251 gene locus_tag LOCUS_20630 58328 59251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 59584 59438 gene locus_tag LOCUS_20640 59584 59438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 60274 60609 gene locus_tag LOCUS_20650 60274 60609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 60775 60687 gene locus_tag LOCUS_t00380 60775 60687 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 61366 61154 gene locus_tag LOCUS_20660 61366 61154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 61444 61719 gene locus_tag LOCUS_20670 61444 61719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 65288 61716 gene locus_tag LOCUS_20680 gene smc 65288 61716 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047863.1 protein_id gnl|my_center|LOCUS_20680 65800 65597 gene locus_tag LOCUS_20690 65800 65597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 67395 66403 gene locus_tag LOCUS_20700 67395 66403 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861434.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20700 67585 67337 gene locus_tag LOCUS_20710 67585 67337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 68288 67704 gene locus_tag LOCUS_20720 gene eamB 68288 67704 CDS product cysteine/O-acetylserine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189223.1 protein_id gnl|my_center|LOCUS_20720 68961 68383 gene locus_tag LOCUS_20730 68961 68383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 68979 69497 gene locus_tag LOCUS_20740 68979 69497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 70878 69682 gene locus_tag LOCUS_20750 70878 69682 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610375.1 protein_id gnl|my_center|LOCUS_20750 71458 71255 gene locus_tag LOCUS_20760 71458 71255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 71888 71430 gene locus_tag LOCUS_20770 71888 71430 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297668.1 protein_id gnl|my_center|LOCUS_20770 72805 72266 gene locus_tag LOCUS_20780 72805 72266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 73488 72802 gene locus_tag LOCUS_20790 73488 72802 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454242.1 protein_id gnl|my_center|LOCUS_20790 74355 73564 gene locus_tag LOCUS_20800 74355 73564 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902187.1 protein_id gnl|my_center|LOCUS_20800 75271 74348 gene locus_tag LOCUS_20810 75271 74348 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861095.1 protein_id gnl|my_center|LOCUS_20810 76321 75398 gene locus_tag LOCUS_20820 76321 75398 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888178.1 protein_id gnl|my_center|LOCUS_20820 77024 76323 gene locus_tag LOCUS_20830 77024 76323 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860731.1 protein_id gnl|my_center|LOCUS_20830 77214 77017 gene locus_tag LOCUS_20840 77214 77017 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434206.1 protein_id gnl|my_center|LOCUS_20840 79905 78787 gene locus_tag LOCUS_20850 79905 78787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 80113 80457 gene locus_tag LOCUS_20860 80113 80457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 80882 81547 gene locus_tag LOCUS_20870 gene vncR 80882 81547 CDS product response regulator transcription factor VncR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697956.1 protein_id gnl|my_center|LOCUS_20870 81544 82641 gene locus_tag LOCUS_20880 81544 82641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 82777 84213 gene locus_tag LOCUS_20890 82777 84213 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889836.1 protein_id gnl|my_center|LOCUS_20890 84227 84862 gene locus_tag LOCUS_20900 84227 84862 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426165.1 protein_id gnl|my_center|LOCUS_20900 84862 85125 gene locus_tag LOCUS_20910 84862 85125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 85552 85983 gene locus_tag LOCUS_20920 85552 85983 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989664.1 protein_id gnl|my_center|LOCUS_20920 85989 86222 gene locus_tag LOCUS_20930 85989 86222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 86336 86509 gene locus_tag LOCUS_20940 86336 86509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 86544 86972 gene locus_tag LOCUS_20950 86544 86972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 87047 87415 gene locus_tag LOCUS_20960 87047 87415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 88319 87468 gene locus_tag LOCUS_20970 88319 87468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 88672 88896 gene locus_tag LOCUS_20980 88672 88896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 88893 89798 gene locus_tag LOCUS_20990 88893 89798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 89954 90571 gene locus_tag LOCUS_21000 89954 90571 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_21000 90746 92500 gene locus_tag LOCUS_21010 90746 92500 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181877.1 protein_id gnl|my_center|LOCUS_21010 92521 94257 gene locus_tag LOCUS_21020 92521 94257 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879268.1 protein_id gnl|my_center|LOCUS_21020 94291 95082 gene locus_tag LOCUS_21030 94291 95082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 95114 96064 gene locus_tag LOCUS_21040 95114 96064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 96414 96707 gene locus_tag LOCUS_21050 96414 96707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 96708 98174 gene locus_tag LOCUS_21060 96708 98174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 98346 98555 gene locus_tag LOCUS_21070 98346 98555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 98622 100271 gene locus_tag LOCUS_21080 98622 100271 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_21080 100219 101529 gene locus_tag LOCUS_21090 100219 101529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 >Feature sequence011 83 1138 gene locus_tag LOCUS_21100 83 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 1161 1679 gene locus_tag LOCUS_21110 1161 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 2088 4058 gene locus_tag LOCUS_21120 2088 4058 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459965.1 protein_id gnl|my_center|LOCUS_21120 4545 4087 gene locus_tag LOCUS_21130 4545 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 4863 5318 gene locus_tag LOCUS_21140 4863 5318 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_21140 5338 6561 gene locus_tag LOCUS_21150 5338 6561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 6771 7046 gene locus_tag LOCUS_21160 6771 7046 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392562.1 protein_id gnl|my_center|LOCUS_21160 7039 7656 gene locus_tag LOCUS_21170 7039 7656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 7677 10049 gene locus_tag LOCUS_21180 7677 10049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 10058 10228 gene locus_tag LOCUS_21190 10058 10228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 10701 10871 gene locus_tag LOCUS_21200 10701 10871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 10895 11284 gene locus_tag LOCUS_21210 gene rbfA 10895 11284 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_21210 11289 12236 gene locus_tag LOCUS_21220 11289 12236 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263149.1 protein_id gnl|my_center|LOCUS_21220 12229 13098 gene locus_tag LOCUS_21230 gene truB 12229 13098 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207806.1 protein_id gnl|my_center|LOCUS_21230 13105 14007 gene locus_tag LOCUS_21240 gene ribF 13105 14007 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769259.1 protein_id gnl|my_center|LOCUS_21240 14014 15384 gene locus_tag LOCUS_21250 14014 15384 CDS product DUF1576 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869156.1 protein_id gnl|my_center|LOCUS_21250 16845 15439 gene locus_tag LOCUS_21260 16845 15439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 17398 16973 gene locus_tag LOCUS_21270 17398 16973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359049.1 protein_id gnl|my_center|LOCUS_21270 17982 17413 gene locus_tag LOCUS_21280 gene efp 17982 17413 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358905.1 protein_id gnl|my_center|LOCUS_21280 19107 18379 gene locus_tag LOCUS_21290 19107 18379 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940552.1 protein_id gnl|my_center|LOCUS_21290 19594 19424 gene locus_tag LOCUS_21300 19594 19424 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888017.1 protein_id gnl|my_center|LOCUS_21300 19715 22144 gene locus_tag LOCUS_21310 19715 22144 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810223.1 protein_id gnl|my_center|LOCUS_21310 22756 22241 gene locus_tag LOCUS_21320 22756 22241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 24103 22769 gene locus_tag LOCUS_21330 24103 22769 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016932.1 protein_id gnl|my_center|LOCUS_21330 25022 24120 gene locus_tag LOCUS_21340 25022 24120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 27967 25019 gene locus_tag LOCUS_21350 27967 25019 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016931.1 protein_id gnl|my_center|LOCUS_21350 30957 28291 gene locus_tag LOCUS_21360 30957 28291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 31334 30954 gene locus_tag LOCUS_21370 31334 30954 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460033.1 protein_id gnl|my_center|LOCUS_21370 31657 31349 gene locus_tag LOCUS_21380 31657 31349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 31840 32460 gene locus_tag LOCUS_21390 31840 32460 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062281989.1 protein_id gnl|my_center|LOCUS_21390 32702 33262 gene locus_tag LOCUS_21400 32702 33262 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965913.1 protein_id gnl|my_center|LOCUS_21400 33259 33915 gene locus_tag LOCUS_21410 33259 33915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 34733 33960 gene locus_tag LOCUS_21420 34733 33960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 34936 34730 gene locus_tag LOCUS_21430 34936 34730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 35165 34920 gene locus_tag LOCUS_21440 35165 34920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 35492 36268 gene locus_tag LOCUS_21450 35492 36268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 36351 37469 gene locus_tag LOCUS_21460 36351 37469 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016893.1 protein_id gnl|my_center|LOCUS_21460 37466 38548 gene locus_tag LOCUS_21470 37466 38548 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816491.1 protein_id gnl|my_center|LOCUS_21470 38552 39895 gene locus_tag LOCUS_21480 38552 39895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 40185 41132 gene locus_tag LOCUS_21490 40185 41132 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257547.1 protein_id gnl|my_center|LOCUS_21490 41613 41170 gene locus_tag LOCUS_21500 gene spoVAC 41613 41170 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944604.1 protein_id gnl|my_center|LOCUS_21500 41725 42240 gene locus_tag LOCUS_21510 41725 42240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 42410 42946 gene locus_tag LOCUS_21520 42410 42946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 43969 43127 gene locus_tag LOCUS_21530 43969 43127 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986756.1 protein_id gnl|my_center|LOCUS_21530 45368 43992 gene locus_tag LOCUS_21540 45368 43992 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964165.1 protein_id gnl|my_center|LOCUS_21540 46536 45385 gene locus_tag LOCUS_21550 46536 45385 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391743.1 protein_id gnl|my_center|LOCUS_21550 46798 47469 gene locus_tag LOCUS_21560 46798 47469 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_21560 47798 48586 gene locus_tag LOCUS_21570 47798 48586 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472638.1 protein_id gnl|my_center|LOCUS_21570 48826 48623 gene locus_tag LOCUS_21580 48826 48623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 49114 48935 gene locus_tag LOCUS_21590 49114 48935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 49414 49629 gene locus_tag LOCUS_21600 49414 49629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 50708 49863 gene locus_tag LOCUS_21610 50708 49863 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948024.1 protein_id gnl|my_center|LOCUS_21610 52064 50718 gene locus_tag LOCUS_21620 gene fepA 52064 50718 CDS product multidrug efflux MATE transporter FepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931796.1 protein_id gnl|my_center|LOCUS_21620 52643 52422 gene locus_tag LOCUS_21630 52643 52422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 52990 54075 gene locus_tag LOCUS_21640 gene serC 52990 54075 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_21640 54141 54650 gene locus_tag LOCUS_21650 54141 54650 CDS product TIGR04002 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888217.1 protein_id gnl|my_center|LOCUS_21650 54665 55513 gene locus_tag LOCUS_21660 54665 55513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 55557 56729 gene locus_tag LOCUS_21670 55557 56729 CDS product 3-phosphoglycerate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490229.1 protein_id gnl|my_center|LOCUS_21670 56742 57500 gene locus_tag LOCUS_21680 56742 57500 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903557.1 protein_id gnl|my_center|LOCUS_21680 57615 58484 gene locus_tag LOCUS_21690 gene metF 57615 58484 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_21690 58943 58584 gene locus_tag LOCUS_21700 58943 58584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 59092 59787 gene locus_tag LOCUS_21710 59092 59787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 59920 60618 gene locus_tag LOCUS_21720 59920 60618 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272573.1 protein_id gnl|my_center|LOCUS_21720 60733 61155 gene locus_tag LOCUS_21730 60733 61155 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_21730 61152 61694 gene locus_tag LOCUS_21740 61152 61694 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419930.1 protein_id gnl|my_center|LOCUS_21740 61713 61868 gene locus_tag LOCUS_21750 61713 61868 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869872.1 protein_id gnl|my_center|LOCUS_21750 63560 62256 gene locus_tag LOCUS_21760 63560 62256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 64935 64288 gene locus_tag LOCUS_21770 64935 64288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 65788 64928 gene locus_tag LOCUS_21780 65788 64928 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390010.1 protein_id gnl|my_center|LOCUS_21780 66164 65781 gene locus_tag LOCUS_21790 66164 65781 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390011.1 protein_id gnl|my_center|LOCUS_21790 67219 66422 gene locus_tag LOCUS_21800 67219 66422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 67560 67231 gene locus_tag LOCUS_21810 67560 67231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 68310 68038 gene locus_tag LOCUS_21820 68310 68038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 68853 68431 gene locus_tag LOCUS_21830 68853 68431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 69680 69033 gene locus_tag LOCUS_21840 69680 69033 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426165.1 protein_id gnl|my_center|LOCUS_21840 69880 69692 gene locus_tag LOCUS_21850 69880 69692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 70574 69897 gene locus_tag LOCUS_21860 70574 69897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 70963 70526 gene locus_tag LOCUS_21870 70963 70526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 71913 71014 gene locus_tag LOCUS_21880 71913 71014 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861119.1 protein_id gnl|my_center|LOCUS_21880 72166 71981 gene locus_tag LOCUS_21890 72166 71981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 72471 72196 gene locus_tag LOCUS_21900 72471 72196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 73412 72483 gene locus_tag LOCUS_21910 73412 72483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 74190 73369 gene locus_tag LOCUS_21920 74190 73369 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355976.1 protein_id gnl|my_center|LOCUS_21920 74379 75611 gene locus_tag LOCUS_21930 74379 75611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 75613 76887 gene locus_tag LOCUS_21940 75613 76887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 76930 77148 gene locus_tag LOCUS_21950 76930 77148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 77316 77558 gene locus_tag LOCUS_21960 77316 77558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 77952 78311 gene locus_tag LOCUS_21970 77952 78311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 79031 78495 gene locus_tag LOCUS_21980 79031 78495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 79151 79336 gene locus_tag LOCUS_21990 79151 79336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 81029 79806 gene locus_tag LOCUS_22000 81029 79806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 81832 81053 gene locus_tag LOCUS_22010 81832 81053 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101106.1 protein_id gnl|my_center|LOCUS_22010 81977 84814 gene locus_tag LOCUS_22020 gene fliD 81977 84814 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987024.1 protein_id gnl|my_center|LOCUS_22020 84839 85225 gene locus_tag LOCUS_22030 84839 85225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 85222 85617 gene locus_tag LOCUS_22040 85222 85617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 86625 85660 gene locus_tag LOCUS_22050 86625 85660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 86752 87453 gene locus_tag LOCUS_22060 gene ftsE 86752 87453 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815584.1 protein_id gnl|my_center|LOCUS_22060 87623 89428 gene locus_tag LOCUS_22070 87623 89428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 89521 91584 gene locus_tag LOCUS_22080 89521 91584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 91599 92549 gene locus_tag LOCUS_22090 91599 92549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 92649 92804 gene locus_tag LOCUS_22100 92649 92804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 92888 93643 gene locus_tag LOCUS_22110 92888 93643 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921670.1 protein_id gnl|my_center|LOCUS_22110 93752 96325 gene locus_tag LOCUS_22120 93752 96325 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_22120 96322 96585 gene locus_tag LOCUS_22130 96322 96585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 96632 97126 gene locus_tag LOCUS_22140 96632 97126 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902172.1 protein_id gnl|my_center|LOCUS_22140 97251 97604 gene locus_tag LOCUS_22150 97251 97604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 97601 97966 gene locus_tag LOCUS_22160 97601 97966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 98893 97979 gene locus_tag LOCUS_22170 gene metA 98893 97979 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796420.1 protein_id gnl|my_center|LOCUS_22170 >Feature sequence012 708 283 gene locus_tag LOCUS_22180 708 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 1602 718 gene locus_tag LOCUS_22190 1602 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 2194 1673 gene locus_tag LOCUS_22200 2194 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 2555 8848 gene locus_tag LOCUS_22210 2555 8848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 10611 9082 gene locus_tag LOCUS_22220 gene spoVB 10611 9082 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964335.1 protein_id gnl|my_center|LOCUS_22220 11418 10729 gene locus_tag LOCUS_22230 11418 10729 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066872391.1 protein_id gnl|my_center|LOCUS_22230 12511 11495 gene locus_tag LOCUS_22240 12511 11495 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975180.1 protein_id gnl|my_center|LOCUS_22240 14448 12538 gene locus_tag LOCUS_22250 14448 12538 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_22250 14954 14445 gene locus_tag LOCUS_22260 14954 14445 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583979.1 protein_id gnl|my_center|LOCUS_22260 16209 14941 gene locus_tag LOCUS_22270 16209 14941 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583978.1 protein_id gnl|my_center|LOCUS_22270 17190 16213 gene locus_tag LOCUS_22280 17190 16213 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192803849.1 protein_id gnl|my_center|LOCUS_22280 18352 17192 gene locus_tag LOCUS_22290 18352 17192 CDS product serine-pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081619.1 protein_id gnl|my_center|LOCUS_22290 18620 19351 gene locus_tag LOCUS_22300 18620 19351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 19398 20612 gene locus_tag LOCUS_22310 gene dpaL 19398 20612 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819571.1 protein_id gnl|my_center|LOCUS_22310 20864 20724 gene locus_tag LOCUS_22320 20864 20724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 21065 21301 gene locus_tag LOCUS_22330 21065 21301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 22042 21329 gene locus_tag LOCUS_22340 22042 21329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 22230 22039 gene locus_tag LOCUS_22350 22230 22039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 22975 23988 gene locus_tag LOCUS_22360 22975 23988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 23991 24524 gene locus_tag LOCUS_22370 23991 24524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 24552 25808 gene locus_tag LOCUS_22380 24552 25808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 27270 25912 gene locus_tag LOCUS_22390 27270 25912 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020392.1 protein_id gnl|my_center|LOCUS_22390 27893 27681 gene locus_tag LOCUS_22400 27893 27681 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885335.1 protein_id gnl|my_center|LOCUS_22400 28554 28225 gene locus_tag LOCUS_22410 28554 28225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 28690 29238 gene locus_tag LOCUS_22420 28690 29238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 29487 32567 gene locus_tag LOCUS_22430 29487 32567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 32680 33717 gene locus_tag LOCUS_22440 32680 33717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 33731 34180 gene locus_tag LOCUS_22450 33731 34180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 34564 34295 gene locus_tag LOCUS_22460 34564 34295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 34887 35099 gene locus_tag LOCUS_22470 34887 35099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 35103 35414 gene locus_tag LOCUS_22480 35103 35414 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393078.1 protein_id gnl|my_center|LOCUS_22480 35414 35644 gene locus_tag LOCUS_22490 35414 35644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 36039 35770 gene locus_tag LOCUS_22500 36039 35770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 36722 36237 gene locus_tag LOCUS_22510 36722 36237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 37091 36753 gene locus_tag LOCUS_22520 37091 36753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 37604 37104 gene locus_tag LOCUS_22530 37604 37104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 38000 37605 gene locus_tag LOCUS_22540 38000 37605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 38179 37997 gene locus_tag LOCUS_22550 38179 37997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 38323 38913 gene locus_tag LOCUS_22560 38323 38913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 38906 40300 gene locus_tag LOCUS_22570 38906 40300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 40680 41507 gene locus_tag LOCUS_22580 40680 41507 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648604.1 protein_id gnl|my_center|LOCUS_22580 41500 42540 gene locus_tag LOCUS_22590 41500 42540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 43449 42592 gene locus_tag LOCUS_22600 43449 42592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 43607 43990 gene locus_tag LOCUS_22610 43607 43990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 44005 44400 gene locus_tag LOCUS_22620 44005 44400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 44480 45397 gene locus_tag LOCUS_22630 44480 45397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 45394 46233 gene locus_tag LOCUS_22640 45394 46233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 46440 47591 gene locus_tag LOCUS_22650 46440 47591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 47732 49735 gene locus_tag LOCUS_22660 47732 49735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 51048 49855 gene locus_tag LOCUS_22670 51048 49855 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610375.1 protein_id gnl|my_center|LOCUS_22670 51339 51136 gene locus_tag LOCUS_22680 51339 51136 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004613735.1 protein_id gnl|my_center|LOCUS_22680 52022 51774 gene locus_tag LOCUS_22690 52022 51774 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905237.1 protein_id gnl|my_center|LOCUS_22690 52449 52006 gene locus_tag LOCUS_22700 52449 52006 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905239.1 protein_id gnl|my_center|LOCUS_22700 53282 52938 gene locus_tag LOCUS_22710 53282 52938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 55607 53289 gene locus_tag LOCUS_22720 55607 53289 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963776.1 protein_id gnl|my_center|LOCUS_22720 56287 55604 gene locus_tag LOCUS_22730 56287 55604 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399472.1 protein_id gnl|my_center|LOCUS_22730 58640 56322 gene locus_tag LOCUS_22740 58640 56322 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948492.1 protein_id gnl|my_center|LOCUS_22740 59197 58637 gene locus_tag LOCUS_22750 59197 58637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 60313 59267 gene locus_tag LOCUS_22760 60313 59267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 61008 60322 gene locus_tag LOCUS_22770 61008 60322 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861224.1 protein_id gnl|my_center|LOCUS_22770 61189 61001 gene locus_tag LOCUS_22780 61189 61001 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434206.1 protein_id gnl|my_center|LOCUS_22780 61359 61712 gene locus_tag LOCUS_22790 61359 61712 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861099.1 protein_id gnl|my_center|LOCUS_22790 61958 62287 gene locus_tag LOCUS_22800 gene mobC 61958 62287 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861100.1 protein_id gnl|my_center|LOCUS_22800 62248 63600 gene locus_tag LOCUS_22810 62248 63600 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861101.1 protein_id gnl|my_center|LOCUS_22810 63603 63860 gene locus_tag LOCUS_22820 63603 63860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 64400 64035 gene locus_tag LOCUS_22830 64400 64035 CDS product cysteine-rich VLP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861105.1 protein_id gnl|my_center|LOCUS_22830 64612 64397 gene locus_tag LOCUS_22840 64612 64397 CDS product transposon-transfer assisting family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861106.1 protein_id gnl|my_center|LOCUS_22840 65568 64615 gene locus_tag LOCUS_22850 65568 64615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 68029 65573 gene locus_tag LOCUS_22860 68029 65573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 68538 68062 gene locus_tag LOCUS_22870 68538 68062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 68797 68528 gene locus_tag LOCUS_22880 68797 68528 CDS product DUF4315 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861111.1 protein_id gnl|my_center|LOCUS_22880 69162 68845 gene locus_tag LOCUS_22890 69162 68845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 70979 69357 gene locus_tag LOCUS_22900 70979 69357 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680024.1 protein_id gnl|my_center|LOCUS_22900 71310 71113 gene locus_tag LOCUS_22910 71310 71113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 72158 71307 gene locus_tag LOCUS_22920 72158 71307 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860782.1 protein_id gnl|my_center|LOCUS_22920 72986 72222 gene locus_tag LOCUS_22930 72986 72222 CDS product phage replisome organizer N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774716.1 protein_id gnl|my_center|LOCUS_22930 73487 73101 gene locus_tag LOCUS_22940 73487 73101 CDS product cysteine-rich VLP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861105.1 protein_id gnl|my_center|LOCUS_22940 75108 73477 gene locus_tag LOCUS_22950 75108 73477 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368703.1 protein_id gnl|my_center|LOCUS_22950 75475 75080 gene locus_tag LOCUS_22960 75475 75080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 76104 75946 gene locus_tag LOCUS_22970 76104 75946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 76920 76666 gene locus_tag LOCUS_22980 76920 76666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 77596 76952 gene locus_tag LOCUS_22990 77596 76952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 78453 77593 gene locus_tag LOCUS_23000 78453 77593 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047975.1 protein_id gnl|my_center|LOCUS_23000 78826 78446 gene locus_tag LOCUS_23010 78826 78446 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566897.1 protein_id gnl|my_center|LOCUS_23010 79393 79253 gene locus_tag LOCUS_23020 79393 79253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 80041 79847 gene locus_tag LOCUS_23030 80041 79847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 80201 80034 gene locus_tag LOCUS_23040 80201 80034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 81981 80194 gene locus_tag LOCUS_23050 81981 80194 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 protein_id gnl|my_center|LOCUS_23050 82460 81978 gene locus_tag LOCUS_23060 82460 81978 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861118.1 protein_id gnl|my_center|LOCUS_23060 82729 82502 gene locus_tag LOCUS_23070 82729 82502 CDS product DUF5348 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610290.1 protein_id gnl|my_center|LOCUS_23070 83738 82761 gene locus_tag LOCUS_23080 83738 82761 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861119.1 protein_id gnl|my_center|LOCUS_23080 84314 85210 gene locus_tag LOCUS_23090 84314 85210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 85240 91365 gene locus_tag LOCUS_23100 85240 91365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23100 91741 91409 gene locus_tag LOCUS_23110 91741 91409 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355924.1 protein_id gnl|my_center|LOCUS_23110 91843 92403 gene locus_tag LOCUS_23120 91843 92403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 92549 92400 gene locus_tag LOCUS_23130 92549 92400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 92808 92575 gene locus_tag LOCUS_23140 92808 92575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 92696 92905 gene locus_tag LOCUS_23150 92696 92905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 92919 93491 gene locus_tag LOCUS_23160 92919 93491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 93373 94650 gene locus_tag LOCUS_23170 93373 94650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 94706 95557 gene locus_tag LOCUS_23180 94706 95557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 95577 96035 gene locus_tag LOCUS_23190 95577 96035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 >Feature sequence013 1589 63 gene locus_tag LOCUS_23200 1589 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 3819 2146 gene locus_tag LOCUS_23210 3819 2146 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888533.1 protein_id gnl|my_center|LOCUS_23210 4289 5827 gene locus_tag LOCUS_23220 gene nhaC 4289 5827 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017141.1 protein_id gnl|my_center|LOCUS_23220 5861 6355 gene locus_tag LOCUS_23230 5861 6355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 6466 8034 gene locus_tag LOCUS_23240 gene hutH 6466 8034 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016650.1 protein_id gnl|my_center|LOCUS_23240 8038 8829 gene locus_tag LOCUS_23250 gene cntK 8038 8829 CDS product histidine racemase CntK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485517.1 protein_id gnl|my_center|LOCUS_23250 8849 9187 gene locus_tag LOCUS_23260 8849 9187 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219429.1 protein_id gnl|my_center|LOCUS_23260 10397 9225 gene locus_tag LOCUS_23270 10397 9225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 10640 12064 gene locus_tag LOCUS_23280 10640 12064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 12061 12657 gene locus_tag LOCUS_23290 12061 12657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 12654 13580 gene locus_tag LOCUS_23300 12654 13580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 13585 14124 gene locus_tag LOCUS_23310 13585 14124 CDS product DUF2716 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886642.1 protein_id gnl|my_center|LOCUS_23310 14108 14569 gene locus_tag LOCUS_23320 14108 14569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 14566 14877 gene locus_tag LOCUS_23330 14566 14877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 14926 15261 gene locus_tag LOCUS_23340 14926 15261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 15258 16565 gene locus_tag LOCUS_23350 gene mtaB 15258 16565 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_23350 16632 17327 gene locus_tag LOCUS_23360 16632 17327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 17840 17367 gene locus_tag LOCUS_23370 17840 17367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 18397 17837 gene locus_tag LOCUS_23380 18397 17837 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433028.1 protein_id gnl|my_center|LOCUS_23380 19338 18481 gene locus_tag LOCUS_23390 19338 18481 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545351.1 protein_id gnl|my_center|LOCUS_23390 21004 19430 gene locus_tag LOCUS_23400 21004 19430 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_23400 21088 21279 gene locus_tag LOCUS_23410 21088 21279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 21756 21556 gene locus_tag LOCUS_23420 21756 21556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 22957 22526 gene locus_tag LOCUS_23430 22957 22526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 24174 22954 gene locus_tag LOCUS_23440 24174 22954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 24331 24212 gene locus_tag LOCUS_23450 24331 24212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 24477 24677 gene locus_tag LOCUS_23460 24477 24677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 24902 24567 gene locus_tag LOCUS_23470 24902 24567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 25299 25223 gene locus_tag LOCUS_t00390 25299 25223 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 25559 25398 gene locus_tag LOCUS_23480 25559 25398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 25702 25556 gene locus_tag LOCUS_23490 25702 25556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 27236 25911 gene locus_tag LOCUS_23500 27236 25911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 30216 27220 gene locus_tag LOCUS_23510 30216 27220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 30513 30307 gene locus_tag LOCUS_23520 30513 30307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 32375 31218 gene locus_tag LOCUS_23530 32375 31218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 34440 32353 gene locus_tag LOCUS_23540 34440 32353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 35895 34852 gene locus_tag LOCUS_23550 35895 34852 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_23550 36798 35980 gene locus_tag LOCUS_23560 36798 35980 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860835.1 protein_id gnl|my_center|LOCUS_23560 37150 37890 gene locus_tag LOCUS_23570 37150 37890 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990032.1 protein_id gnl|my_center|LOCUS_23570 37955 39007 gene locus_tag LOCUS_23580 37955 39007 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401457.1 protein_id gnl|my_center|LOCUS_23580 39094 39600 gene locus_tag LOCUS_23590 39094 39600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 39597 40889 gene locus_tag LOCUS_23600 gene dctM 39597 40889 CDS product C4-dicarboxylate TRAP transporter large permease protein DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105529.1 protein_id gnl|my_center|LOCUS_23600 41126 42607 gene locus_tag LOCUS_23610 41126 42607 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020866.1 protein_id gnl|my_center|LOCUS_23610 42609 43478 gene locus_tag LOCUS_23620 42609 43478 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785992.1 protein_id gnl|my_center|LOCUS_23620 43934 44491 gene locus_tag LOCUS_23630 43934 44491 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358306.1 protein_id gnl|my_center|LOCUS_23630 46626 44497 gene locus_tag LOCUS_23640 46626 44497 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_23640 49321 46643 gene locus_tag LOCUS_23650 49321 46643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 49786 50280 gene locus_tag LOCUS_23660 49786 50280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 55347 50347 gene locus_tag LOCUS_23670 55347 50347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 55839 57260 gene locus_tag LOCUS_23680 55839 57260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 57397 58059 gene locus_tag LOCUS_23690 57397 58059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 58178 59074 gene locus_tag LOCUS_23700 58178 59074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 59745 59353 gene locus_tag LOCUS_23710 59745 59353 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949091.1 protein_id gnl|my_center|LOCUS_23710 59892 60104 gene locus_tag LOCUS_23720 59892 60104 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360986.1 protein_id gnl|my_center|LOCUS_23720 60118 60339 gene locus_tag LOCUS_23730 60118 60339 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_23730 60392 62776 gene locus_tag LOCUS_23740 60392 62776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 62790 62930 gene locus_tag LOCUS_23750 62790 62930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 63099 63965 gene locus_tag LOCUS_23760 63099 63965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 64093 65163 gene locus_tag LOCUS_23770 64093 65163 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 protein_id gnl|my_center|LOCUS_23770 65247 66734 gene locus_tag LOCUS_23780 65247 66734 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_23780 66744 68297 gene locus_tag LOCUS_23790 66744 68297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 69101 68349 gene locus_tag LOCUS_23800 69101 68349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 70002 69106 gene locus_tag LOCUS_23810 70002 69106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 70701 70123 gene locus_tag LOCUS_23820 70701 70123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 70939 70682 gene locus_tag LOCUS_23830 70939 70682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 71174 70920 gene locus_tag LOCUS_23840 71174 70920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 71808 71158 gene locus_tag LOCUS_23850 71808 71158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 72614 71943 gene locus_tag LOCUS_23860 gene tsaA 72614 71943 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_23860 73090 72662 gene locus_tag LOCUS_23870 73090 72662 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963997.1 protein_id gnl|my_center|LOCUS_23870 73536 73207 gene locus_tag LOCUS_23880 73536 73207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 73650 73844 gene locus_tag LOCUS_23890 73650 73844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 75796 73880 gene locus_tag LOCUS_23900 gene htpG 75796 73880 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986521.1 protein_id gnl|my_center|LOCUS_23900 75978 76991 gene locus_tag LOCUS_23910 75978 76991 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048128.1 protein_id gnl|my_center|LOCUS_23910 77252 77716 gene locus_tag LOCUS_23920 77252 77716 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809864.1 protein_id gnl|my_center|LOCUS_23920 77805 79271 gene locus_tag LOCUS_23930 77805 79271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 79395 80534 gene locus_tag LOCUS_23940 79395 80534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 80813 80568 gene locus_tag LOCUS_23950 80813 80568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 81307 80810 gene locus_tag LOCUS_23960 81307 80810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 82554 81304 gene locus_tag LOCUS_23970 82554 81304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 84015 82573 gene locus_tag LOCUS_23980 84015 82573 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966495.1 protein_id gnl|my_center|LOCUS_23980 84775 84083 gene locus_tag LOCUS_23990 84775 84083 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_23990 86080 84905 gene locus_tag LOCUS_24000 86080 84905 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048277.1 protein_id gnl|my_center|LOCUS_24000 >Feature sequence014 213 52 gene locus_tag LOCUS_24010 213 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 740 246 gene locus_tag LOCUS_24020 740 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 945 859 gene locus_tag LOCUS_t00400 945 859 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1310 2065 gene locus_tag LOCUS_24030 gene larE 1310 2065 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964093.1 protein_id gnl|my_center|LOCUS_24030 2079 2837 gene locus_tag LOCUS_24040 gene larB 2079 2837 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947959.1 protein_id gnl|my_center|LOCUS_24040 2834 4063 gene locus_tag LOCUS_24050 gene larC 2834 4063 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393989.1 protein_id gnl|my_center|LOCUS_24050 4156 5688 gene locus_tag LOCUS_24060 4156 5688 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461189.1 protein_id gnl|my_center|LOCUS_24060 5685 6665 gene locus_tag LOCUS_24070 5685 6665 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021910.1 protein_id gnl|my_center|LOCUS_24070 6662 7480 gene locus_tag LOCUS_24080 6662 7480 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816583.1 protein_id gnl|my_center|LOCUS_24080 7490 8287 gene locus_tag LOCUS_24090 7490 8287 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461569.1 protein_id gnl|my_center|LOCUS_24090 8284 8901 gene locus_tag LOCUS_24100 8284 8901 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272615.1 protein_id gnl|my_center|LOCUS_24100 8898 9041 gene locus_tag LOCUS_24110 8898 9041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 10096 9272 gene locus_tag LOCUS_24120 10096 9272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 13816 10103 gene locus_tag LOCUS_24130 13816 10103 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068298.1 protein_id gnl|my_center|LOCUS_24130 15423 13903 gene locus_tag LOCUS_24140 15423 13903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 16249 15437 gene locus_tag LOCUS_24150 gene pgeF 16249 15437 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_24150 16616 16404 gene locus_tag LOCUS_24160 16616 16404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 16893 17606 gene locus_tag LOCUS_24170 16893 17606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 17603 17974 gene locus_tag LOCUS_24180 17603 17974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 19138 18230 gene locus_tag LOCUS_24190 19138 18230 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989345.1 protein_id gnl|my_center|LOCUS_24190 19433 20824 gene locus_tag LOCUS_24200 19433 20824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 20923 21795 gene locus_tag LOCUS_24210 20923 21795 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624137.1 protein_id gnl|my_center|LOCUS_24210 21808 22698 gene locus_tag LOCUS_24220 21808 22698 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530307.1 protein_id gnl|my_center|LOCUS_24220 22786 22989 gene locus_tag LOCUS_24230 22786 22989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 23002 25176 gene locus_tag LOCUS_24240 gene gnpA 23002 25176 CDS product 1,3-beta-galactosyl-N-acetylhexosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389962.1 protein_id gnl|my_center|LOCUS_24240 26332 25349 gene locus_tag LOCUS_24250 26332 25349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 26967 26329 gene locus_tag LOCUS_24260 gene eda 26967 26329 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_24260 28520 27036 gene locus_tag LOCUS_24270 28520 27036 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000463030.1 protein_id gnl|my_center|LOCUS_24270 29003 28536 gene locus_tag LOCUS_24280 29003 28536 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726681.1 protein_id gnl|my_center|LOCUS_24280 30154 29105 gene locus_tag LOCUS_24290 30154 29105 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589805.1 protein_id gnl|my_center|LOCUS_24290 31393 30368 gene locus_tag LOCUS_24300 31393 30368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 32469 31525 gene locus_tag LOCUS_24310 32469 31525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 33134 32808 gene locus_tag LOCUS_24320 33134 32808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 33272 33565 gene locus_tag LOCUS_24330 33272 33565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 33876 33709 gene locus_tag LOCUS_24340 33876 33709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 33966 34088 gene locus_tag LOCUS_24350 33966 34088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 35778 34153 gene locus_tag LOCUS_24360 gene groL 35778 34153 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965990.1 protein_id gnl|my_center|LOCUS_24360 36241 35957 gene locus_tag LOCUS_24370 36241 35957 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_24370 36528 36680 gene locus_tag LOCUS_24380 36528 36680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 36990 36748 gene locus_tag LOCUS_24390 36990 36748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 37137 37334 gene locus_tag LOCUS_24400 37137 37334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 38233 37304 gene locus_tag LOCUS_24410 38233 37304 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927052.1 protein_id gnl|my_center|LOCUS_24410 39419 38304 gene locus_tag LOCUS_24420 39419 38304 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732062.1 protein_id gnl|my_center|LOCUS_24420 40499 39471 gene locus_tag LOCUS_24430 40499 39471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 41341 40496 gene locus_tag LOCUS_24440 gene murI 41341 40496 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545640.1 protein_id gnl|my_center|LOCUS_24440 42229 41414 gene locus_tag LOCUS_24450 42229 41414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 43567 42233 gene locus_tag LOCUS_24460 43567 42233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 45362 43584 gene locus_tag LOCUS_24470 gene walK 45362 43584 CDS product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288851.1 protein_id gnl|my_center|LOCUS_24470 46118 45414 gene locus_tag LOCUS_24480 gene yycF 46118 45414 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262930.1 protein_id gnl|my_center|LOCUS_24480 46685 46143 gene locus_tag LOCUS_24490 46685 46143 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_24490 47172 46945 gene locus_tag LOCUS_24500 47172 46945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 47290 47544 gene locus_tag LOCUS_24510 47290 47544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 48017 47640 gene locus_tag LOCUS_24520 gene rplL 48017 47640 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357259.1 protein_id gnl|my_center|LOCUS_24520 48641 48090 gene locus_tag LOCUS_24530 gene rplJ 48641 48090 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235042.1 protein_id gnl|my_center|LOCUS_24530 48934 49566 gene locus_tag LOCUS_24540 48934 49566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 49776 50693 gene locus_tag LOCUS_24550 49776 50693 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136856750.1 protein_id gnl|my_center|LOCUS_24550 50714 51397 gene locus_tag LOCUS_24560 50714 51397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 51841 52761 gene locus_tag LOCUS_24570 gene spoIIIAA 51841 52761 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272423.1 protein_id gnl|my_center|LOCUS_24570 52762 53271 gene locus_tag LOCUS_24580 52762 53271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 53305 53499 gene locus_tag LOCUS_24590 gene spoIIIAC 53305 53499 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358967.1 protein_id gnl|my_center|LOCUS_24590 53496 53888 gene locus_tag LOCUS_24600 53496 53888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 53885 54946 gene locus_tag LOCUS_24610 53885 54946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 54943 55440 gene locus_tag LOCUS_24620 54943 55440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 55437 55952 gene locus_tag LOCUS_24630 55437 55952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 56154 56801 gene locus_tag LOCUS_24640 56154 56801 CDS product SpoIIIAH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393038.1 protein_id gnl|my_center|LOCUS_24640 57983 56898 gene locus_tag LOCUS_24650 57983 56898 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_24650 60452 58227 gene locus_tag LOCUS_24660 60452 58227 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423561.1 protein_id gnl|my_center|LOCUS_24660 60920 60750 gene locus_tag LOCUS_24670 60920 60750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 62476 60989 gene locus_tag LOCUS_24680 62476 60989 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965898.1 protein_id gnl|my_center|LOCUS_24680 63124 62489 gene locus_tag LOCUS_24690 63124 62489 CDS product DUF4867 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965899.1 protein_id gnl|my_center|LOCUS_24690 64614 63139 gene locus_tag LOCUS_24700 gene xylB 64614 63139 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_24700 65804 64626 gene locus_tag LOCUS_24710 gene gguB 65804 64626 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535527.1 protein_id gnl|my_center|LOCUS_24710 67362 65821 gene locus_tag LOCUS_24720 gene gguA 67362 65821 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533633.1 protein_id gnl|my_center|LOCUS_24720 68650 67457 gene locus_tag LOCUS_24730 gene chvE 68650 67457 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727839.1 protein_id gnl|my_center|LOCUS_24730 68983 70122 gene locus_tag LOCUS_24740 68983 70122 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068741.1 protein_id gnl|my_center|LOCUS_24740 70179 70532 gene locus_tag LOCUS_24750 70179 70532 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459556.1 protein_id gnl|my_center|LOCUS_24750 72371 71049 gene locus_tag LOCUS_24760 72371 71049 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048319.1 protein_id gnl|my_center|LOCUS_24760 73209 72622 gene locus_tag LOCUS_24770 73209 72622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 73565 74548 gene locus_tag LOCUS_24780 73565 74548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 75840 74755 gene locus_tag LOCUS_24790 75840 74755 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_24790 76027 76869 gene locus_tag LOCUS_24800 gene kduI 76027 76869 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383248.1 protein_id gnl|my_center|LOCUS_24800 76879 77679 gene locus_tag LOCUS_24810 76879 77679 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965895.1 protein_id gnl|my_center|LOCUS_24810 77823 78497 gene locus_tag LOCUS_24820 77823 78497 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013845097.1 protein_id gnl|my_center|LOCUS_24820 79340 78582 gene locus_tag LOCUS_24830 79340 78582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 79484 80278 gene locus_tag LOCUS_24840 79484 80278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 >Feature sequence015 1071 2243 gene locus_tag LOCUS_24850 1071 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 2307 2522 gene locus_tag LOCUS_24860 2307 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 2758 3081 gene locus_tag LOCUS_24870 2758 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 3096 3566 gene locus_tag LOCUS_24880 3096 3566 CDS product LURP-one-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190192.1 protein_id gnl|my_center|LOCUS_24880 3659 3877 gene locus_tag LOCUS_24890 3659 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 3891 4025 gene locus_tag LOCUS_24900 3891 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 4065 5072 gene locus_tag LOCUS_24910 4065 5072 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24910 5445 5369 gene locus_tag LOCUS_t00410 5445 5369 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5551 6603 gene locus_tag LOCUS_24920 5551 6603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 6600 7217 gene locus_tag LOCUS_24930 6600 7217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 7253 9097 gene locus_tag LOCUS_24940 7253 9097 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099491.1 protein_id gnl|my_center|LOCUS_24940 9090 9755 gene locus_tag LOCUS_24950 9090 9755 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438070.1 protein_id gnl|my_center|LOCUS_24950 9974 10156 gene locus_tag LOCUS_24960 9974 10156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 10160 10525 gene locus_tag LOCUS_24970 10160 10525 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_24970 10776 11921 gene locus_tag LOCUS_24980 10776 11921 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566189.1 protein_id gnl|my_center|LOCUS_24980 11940 12065 gene locus_tag LOCUS_24990 11940 12065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 12354 12088 gene locus_tag LOCUS_25000 12354 12088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 14124 12943 gene locus_tag LOCUS_25010 gene ylbJ 14124 12943 CDS product sporulation integral membrane protein YlbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392455.1 protein_id gnl|my_center|LOCUS_25010 14294 15331 gene locus_tag LOCUS_25020 14294 15331 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141484866.1 protein_id gnl|my_center|LOCUS_25020 15325 15930 gene locus_tag LOCUS_25030 15325 15930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 15927 16574 gene locus_tag LOCUS_25040 15927 16574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 16593 17858 gene locus_tag LOCUS_25050 16593 17858 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964978.1 protein_id gnl|my_center|LOCUS_25050 17868 18641 gene locus_tag LOCUS_25060 17868 18641 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681078.1 protein_id gnl|my_center|LOCUS_25060 19783 18677 gene locus_tag LOCUS_25070 19783 18677 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861460.1 protein_id gnl|my_center|LOCUS_25070 21002 19821 gene locus_tag LOCUS_25080 21002 19821 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930700.1 protein_id gnl|my_center|LOCUS_25080 21165 22358 gene locus_tag LOCUS_25090 21165 22358 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460506.1 protein_id gnl|my_center|LOCUS_25090 22462 22839 gene locus_tag LOCUS_25100 22462 22839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 22922 23122 gene locus_tag LOCUS_25110 22922 23122 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_25110 23142 24029 gene locus_tag LOCUS_25120 23142 24029 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459741.1 protein_id gnl|my_center|LOCUS_25120 24334 25377 gene locus_tag LOCUS_25130 24334 25377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 25793 25446 gene locus_tag LOCUS_25140 25793 25446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 26173 25841 gene locus_tag LOCUS_25150 26173 25841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 26402 26902 gene locus_tag LOCUS_25160 gene nusB 26402 26902 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358828.1 protein_id gnl|my_center|LOCUS_25160 26902 27834 gene locus_tag LOCUS_25170 26902 27834 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393029.1 protein_id gnl|my_center|LOCUS_25170 27831 29090 gene locus_tag LOCUS_25180 gene xseA 27831 29090 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_25180 29116 29352 gene locus_tag LOCUS_25190 29116 29352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 29336 30232 gene locus_tag LOCUS_25200 29336 30232 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810943.1 protein_id gnl|my_center|LOCUS_25200 30259 32127 gene locus_tag LOCUS_25210 gene dxs 30259 32127 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_25210 32108 32920 gene locus_tag LOCUS_25220 32108 32920 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358964.1 protein_id gnl|my_center|LOCUS_25220 32917 33789 gene locus_tag LOCUS_25230 32917 33789 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_25230 33786 34238 gene locus_tag LOCUS_25240 33786 34238 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986439.1 protein_id gnl|my_center|LOCUS_25240 34260 35948 gene locus_tag LOCUS_25250 gene recN 34260 35948 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230267.1 protein_id gnl|my_center|LOCUS_25250 35962 36456 gene locus_tag LOCUS_25260 35962 36456 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_25260 37931 36504 gene locus_tag LOCUS_25270 37931 36504 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925421.1 protein_id gnl|my_center|LOCUS_25270 38164 39336 gene locus_tag LOCUS_25280 38164 39336 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_25280 39339 39749 gene locus_tag LOCUS_25290 39339 39749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 39746 40258 gene locus_tag LOCUS_25300 39746 40258 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301974.1 protein_id gnl|my_center|LOCUS_25300 40263 40730 gene locus_tag LOCUS_25310 40263 40730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 41094 41924 gene locus_tag LOCUS_25320 41094 41924 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020824.1 protein_id gnl|my_center|LOCUS_25320 41921 42364 gene locus_tag LOCUS_25330 41921 42364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 42392 43615 gene locus_tag LOCUS_25340 gene tyrS 42392 43615 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_25340 43634 44089 gene locus_tag LOCUS_25350 43634 44089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 44148 44639 gene locus_tag LOCUS_25360 44148 44639 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547510.1 protein_id gnl|my_center|LOCUS_25360 44764 45798 gene locus_tag LOCUS_25370 44764 45798 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_25370 45824 46174 gene locus_tag LOCUS_25380 45824 46174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 47359 46229 gene locus_tag LOCUS_25390 47359 46229 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_25390 48372 47431 gene locus_tag LOCUS_25400 48372 47431 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964363.1 protein_id gnl|my_center|LOCUS_25400 50369 48396 gene locus_tag LOCUS_25410 gene ligA 50369 48396 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812372.1 protein_id gnl|my_center|LOCUS_25410 51045 50362 gene locus_tag LOCUS_25420 51045 50362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 51777 51070 gene locus_tag LOCUS_25430 gene yunB 51777 51070 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393210.1 protein_id gnl|my_center|LOCUS_25430 52038 51823 gene locus_tag LOCUS_25440 52038 51823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 53321 52068 gene locus_tag LOCUS_25450 53321 52068 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965138.1 protein_id gnl|my_center|LOCUS_25450 53768 53322 gene locus_tag LOCUS_25460 53768 53322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 55167 53782 gene locus_tag LOCUS_25470 gene murD 55167 53782 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048369.1 protein_id gnl|my_center|LOCUS_25470 55727 55296 gene locus_tag LOCUS_25480 55727 55296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 56628 55747 gene locus_tag LOCUS_25490 gene xerD 56628 55747 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_25490 57272 56652 gene locus_tag LOCUS_25500 57272 56652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 58982 57561 gene locus_tag LOCUS_25510 gene scfB 58982 57561 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_25510 59490 59002 gene locus_tag LOCUS_25520 59490 59002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 59931 59503 gene locus_tag LOCUS_25530 59931 59503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 60149 60009 gene locus_tag LOCUS_25540 gene scfA 60149 60009 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_25540 60660 60232 gene locus_tag LOCUS_25550 60660 60232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 61008 60727 gene locus_tag LOCUS_25560 61008 60727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 62265 61126 gene locus_tag LOCUS_25570 gene tgt 62265 61126 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_25570 62820 62299 gene locus_tag LOCUS_25580 62820 62299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 63098 62841 gene locus_tag LOCUS_25590 63098 62841 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948437.1 protein_id gnl|my_center|LOCUS_25590 64144 63113 gene locus_tag LOCUS_25600 gene queA 64144 63113 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048087.1 protein_id gnl|my_center|LOCUS_25600 65960 64164 gene locus_tag LOCUS_25610 65960 64164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 66214 67311 gene locus_tag LOCUS_25620 gene asd 66214 67311 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963351.1 protein_id gnl|my_center|LOCUS_25620 67331 68221 gene locus_tag LOCUS_25630 gene dapA 67331 68221 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965674.1 protein_id gnl|my_center|LOCUS_25630 68233 68988 gene locus_tag LOCUS_25640 gene dapB 68233 68988 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048150.1 protein_id gnl|my_center|LOCUS_25640 69050 69475 gene locus_tag LOCUS_25650 69050 69475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 69544 70128 gene locus_tag LOCUS_25660 69544 70128 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943659.1 protein_id gnl|my_center|LOCUS_25660 70142 70885 gene locus_tag LOCUS_25670 70142 70885 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_25670 70988 71185 gene locus_tag LOCUS_25680 70988 71185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 72484 71114 gene locus_tag LOCUS_25690 gene radA 72484 71114 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_25690 72793 72542 gene locus_tag LOCUS_25700 72793 72542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 73553 72855 gene locus_tag LOCUS_25710 gene cwlD 73553 72855 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966373.1 protein_id gnl|my_center|LOCUS_25710 73700 74206 gene locus_tag LOCUS_25720 73700 74206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 74207 74632 gene locus_tag LOCUS_25730 74207 74632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 75488 74811 gene locus_tag LOCUS_25740 75488 74811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 77252 75567 gene locus_tag LOCUS_25750 77252 75567 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_25750 77685 77494 gene locus_tag LOCUS_25760 77685 77494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 77941 78432 gene locus_tag LOCUS_25770 77941 78432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25770 >Feature sequence016 <1 1043 gene locus_tag LOCUS_25780 <1 1043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007052464.1:WYL domain-containing protein 1251 1499 gene locus_tag LOCUS_25790 1251 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 1471 1635 gene locus_tag LOCUS_25800 1471 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 2624 1887 gene locus_tag LOCUS_25810 2624 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 3181 2621 gene locus_tag LOCUS_25820 3181 2621 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840041.1 protein_id gnl|my_center|LOCUS_25820 4522 3332 gene locus_tag LOCUS_25830 4522 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 5254 4577 gene locus_tag LOCUS_25840 5254 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 6362 5649 gene locus_tag LOCUS_25850 6362 5649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 7543 6359 gene locus_tag LOCUS_25860 7543 6359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 7723 8397 gene locus_tag LOCUS_25870 7723 8397 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582912.1 protein_id gnl|my_center|LOCUS_25870 8394 9506 gene locus_tag LOCUS_25880 8394 9506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 9631 11691 gene locus_tag LOCUS_25890 9631 11691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 11696 12892 gene locus_tag LOCUS_25900 11696 12892 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_25900 12993 13475 gene locus_tag LOCUS_25910 12993 13475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 13480 14163 gene locus_tag LOCUS_25920 13480 14163 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963642.1 protein_id gnl|my_center|LOCUS_25920 14314 14916 gene locus_tag LOCUS_25930 14314 14916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 15068 15742 gene locus_tag LOCUS_25940 15068 15742 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861403.1 protein_id gnl|my_center|LOCUS_25940 15739 18216 gene locus_tag LOCUS_25950 15739 18216 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814229.1 protein_id gnl|my_center|LOCUS_25950 19487 18693 gene locus_tag LOCUS_25960 19487 18693 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836451.1 protein_id gnl|my_center|LOCUS_25960 20211 19477 gene locus_tag LOCUS_25970 20211 19477 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073287660.1 protein_id gnl|my_center|LOCUS_25970 20937 20212 gene locus_tag LOCUS_25980 20937 20212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 22171 20930 gene locus_tag LOCUS_25990 22171 20930 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888369.1 protein_id gnl|my_center|LOCUS_25990 23248 22238 gene locus_tag LOCUS_26000 23248 22238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 23382 23927 gene locus_tag LOCUS_26010 23382 23927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26010 23970 24275 gene locus_tag LOCUS_26020 23970 24275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26020 24297 25169 gene locus_tag LOCUS_26030 24297 25169 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680498.1 protein_id gnl|my_center|LOCUS_26030 25254 25700 gene locus_tag LOCUS_26040 25254 25700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 25697 26122 gene locus_tag LOCUS_26050 25697 26122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 26692 26348 gene locus_tag LOCUS_26060 26692 26348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 26817 27347 gene locus_tag LOCUS_26070 26817 27347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 27839 27390 gene locus_tag LOCUS_26080 27839 27390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 28009 28563 gene locus_tag LOCUS_26090 28009 28563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 28560 29399 gene locus_tag LOCUS_26100 28560 29399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 29426 30196 gene locus_tag LOCUS_26110 29426 30196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 30669 31400 gene locus_tag LOCUS_26120 30669 31400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 31643 32227 gene locus_tag LOCUS_26130 31643 32227 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896761.1 protein_id gnl|my_center|LOCUS_26130 32703 33248 gene locus_tag LOCUS_26140 32703 33248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 33520 33245 gene locus_tag LOCUS_26150 33520 33245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 33842 34102 gene locus_tag LOCUS_26160 33842 34102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 34308 34643 gene locus_tag LOCUS_26170 34308 34643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 34684 35079 gene locus_tag LOCUS_26180 34684 35079 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068146.1 protein_id gnl|my_center|LOCUS_26180 35088 35876 gene locus_tag LOCUS_26190 35088 35876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 35929 36990 gene locus_tag LOCUS_26200 gene rseP 35929 36990 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965102.1 protein_id gnl|my_center|LOCUS_26200 37132 38391 gene locus_tag LOCUS_26210 37132 38391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 38428 39699 gene locus_tag LOCUS_26220 38428 39699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 39792 41234 gene locus_tag LOCUS_26230 39792 41234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 41366 42256 gene locus_tag LOCUS_26240 41366 42256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 42279 42488 gene locus_tag LOCUS_26250 42279 42488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 42937 43503 gene locus_tag LOCUS_26260 42937 43503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 43654 43887 gene locus_tag LOCUS_26270 43654 43887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 44170 44487 gene locus_tag LOCUS_26280 44170 44487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 44484 44681 gene locus_tag LOCUS_26290 44484 44681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 44849 45475 gene locus_tag LOCUS_26300 44849 45475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 45493 46296 gene locus_tag LOCUS_26310 45493 46296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 46377 46715 gene locus_tag LOCUS_26320 46377 46715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 46770 47330 gene locus_tag LOCUS_26330 46770 47330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 47342 47800 gene locus_tag LOCUS_26340 47342 47800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 48678 48292 gene locus_tag LOCUS_26350 48678 48292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 48880 49431 gene locus_tag LOCUS_26360 48880 49431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 49538 49885 gene locus_tag LOCUS_26370 49538 49885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 49872 50615 gene locus_tag LOCUS_26380 49872 50615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 50631 52493 gene locus_tag LOCUS_26390 50631 52493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 52534 54807 gene locus_tag LOCUS_26400 52534 54807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 54876 55409 gene locus_tag LOCUS_26410 54876 55409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 55447 56679 gene locus_tag LOCUS_26420 55447 56679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 56831 57607 gene locus_tag LOCUS_26430 56831 57607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 57597 58160 gene locus_tag LOCUS_26440 57597 58160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 58201 58638 gene locus_tag LOCUS_26450 58201 58638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 58713 59825 gene locus_tag LOCUS_26460 58713 59825 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460692.1 protein_id gnl|my_center|LOCUS_26460 59910 60839 gene locus_tag LOCUS_26470 59910 60839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 61028 61606 gene locus_tag LOCUS_26480 61028 61606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 61884 63026 gene locus_tag LOCUS_26490 61884 63026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 63026 64063 gene locus_tag LOCUS_26500 63026 64063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 64132 64812 gene locus_tag LOCUS_26510 64132 64812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 64822 66999 gene locus_tag LOCUS_26520 64822 66999 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256716.1 protein_id gnl|my_center|LOCUS_26520 67018 67491 gene locus_tag LOCUS_26530 67018 67491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 67488 68240 gene locus_tag LOCUS_26540 67488 68240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 68237 68623 gene locus_tag LOCUS_26550 68237 68623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 68689 69792 gene locus_tag LOCUS_26560 68689 69792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 69825 70088 gene locus_tag LOCUS_26570 69825 70088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 70075 70455 gene locus_tag LOCUS_26580 70075 70455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 70564 70743 gene locus_tag LOCUS_26590 70564 70743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 70998 71201 gene locus_tag LOCUS_26600 70998 71201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 71217 71489 gene locus_tag LOCUS_26610 71217 71489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 71681 73189 gene locus_tag LOCUS_26620 71681 73189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 73278 73469 gene locus_tag LOCUS_26630 73278 73469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 73510 73851 gene locus_tag LOCUS_26640 73510 73851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 73853 74296 gene locus_tag LOCUS_26650 73853 74296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 74316 74777 gene locus_tag LOCUS_26660 gene tnpA 74316 74777 CDS product IS200/IS605-like element ISEfa4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287522.1 protein_id gnl|my_center|LOCUS_26660 74877 75242 gene locus_tag LOCUS_26670 74877 75242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 75304 75786 gene locus_tag LOCUS_26680 75304 75786 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368727.1 protein_id gnl|my_center|LOCUS_26680 >Feature sequence017 199 396 gene locus_tag LOCUS_26690 199 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 633 457 gene locus_tag LOCUS_26700 633 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 864 646 gene locus_tag LOCUS_26710 864 646 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890274.1 protein_id gnl|my_center|LOCUS_26710 1298 1017 gene locus_tag LOCUS_26720 1298 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 1402 1680 gene locus_tag LOCUS_26730 1402 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 2151 1840 gene locus_tag LOCUS_26740 2151 1840 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817080.1 protein_id gnl|my_center|LOCUS_26740 2407 2138 gene locus_tag LOCUS_26750 2407 2138 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272532.1 protein_id gnl|my_center|LOCUS_26750 2858 2511 gene locus_tag LOCUS_26760 2858 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 3010 3165 gene locus_tag LOCUS_26770 3010 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 4192 3479 gene locus_tag LOCUS_26780 4192 3479 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891221.1 protein_id gnl|my_center|LOCUS_26780 5581 4193 gene locus_tag LOCUS_26790 5581 4193 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422669.1 protein_id gnl|my_center|LOCUS_26790 7353 5578 gene locus_tag LOCUS_26800 7353 5578 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426762.1 protein_id gnl|my_center|LOCUS_26800 7788 7480 gene locus_tag LOCUS_26810 7788 7480 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986934.1 protein_id gnl|my_center|LOCUS_26810 8789 7803 gene locus_tag LOCUS_26820 8789 7803 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439726.1 protein_id gnl|my_center|LOCUS_26820 9493 8807 gene locus_tag LOCUS_26830 9493 8807 CDS product V-type ATP synthase subunit E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986936.1 protein_id gnl|my_center|LOCUS_26830 10059 9517 gene locus_tag LOCUS_26840 10059 9517 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869602.1 protein_id gnl|my_center|LOCUS_26840 12015 10075 gene locus_tag LOCUS_26850 12015 10075 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898067.1 protein_id gnl|my_center|LOCUS_26850 12329 12015 gene locus_tag LOCUS_26860 12329 12015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 13617 12529 gene locus_tag LOCUS_26870 13617 12529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 14481 13747 gene locus_tag LOCUS_26880 14481 13747 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_26880 14829 14494 gene locus_tag LOCUS_26890 gene azlD 14829 14494 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 protein_id gnl|my_center|LOCUS_26890 15533 14820 gene locus_tag LOCUS_26900 15533 14820 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460301.1 protein_id gnl|my_center|LOCUS_26900 15709 16602 gene locus_tag LOCUS_26910 15709 16602 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_26910 17040 16654 gene locus_tag LOCUS_26920 gene rsfS 17040 16654 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_26920 18620 17064 gene locus_tag LOCUS_26930 18620 17064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 19836 18625 gene locus_tag LOCUS_26940 19836 18625 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679466.1 protein_id gnl|my_center|LOCUS_26940 20430 20107 gene locus_tag LOCUS_26950 gene yhbY 20430 20107 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358089.1 protein_id gnl|my_center|LOCUS_26950 21108 20515 gene locus_tag LOCUS_26960 gene rdgB 21108 20515 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028655.1 protein_id gnl|my_center|LOCUS_26960 22247 21378 gene locus_tag LOCUS_26970 gene ftsY 22247 21378 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249530.1 protein_id gnl|my_center|LOCUS_26970 22565 22260 gene locus_tag LOCUS_26980 22565 22260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 22858 22565 gene locus_tag LOCUS_26990 22858 22565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 24127 23438 gene locus_tag LOCUS_27000 24127 23438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 24855 24139 gene locus_tag LOCUS_27010 24855 24139 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947949.1 protein_id gnl|my_center|LOCUS_27010 28354 24884 gene locus_tag LOCUS_27020 28354 24884 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_27020 28680 28381 gene locus_tag LOCUS_27030 28680 28381 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755918.1 protein_id gnl|my_center|LOCUS_27030 28777 28968 gene locus_tag LOCUS_27040 28777 28968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 29360 28875 gene locus_tag LOCUS_27050 29360 28875 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461289.1 protein_id gnl|my_center|LOCUS_27050 29745 29413 gene locus_tag LOCUS_27060 29745 29413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 30636 29749 gene locus_tag LOCUS_27070 gene whiA 30636 29749 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436252.1 protein_id gnl|my_center|LOCUS_27070 31679 30639 gene locus_tag LOCUS_27080 31679 30639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 31872 31672 gene locus_tag LOCUS_27090 31872 31672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 32142 31978 gene locus_tag LOCUS_27100 32142 31978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 33018 32155 gene locus_tag LOCUS_27110 gene rapZ 33018 32155 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_27110 33500 33054 gene locus_tag LOCUS_27120 33500 33054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 34426 33497 gene locus_tag LOCUS_27130 gene murB 34426 33497 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_27130 35840 34752 gene locus_tag LOCUS_27140 gene buk 35840 34752 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454677.1 protein_id gnl|my_center|LOCUS_27140 36750 35830 gene locus_tag LOCUS_27150 36750 35830 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460303.1 protein_id gnl|my_center|LOCUS_27150 37097 37549 gene locus_tag LOCUS_27160 37097 37549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 37552 38931 gene locus_tag LOCUS_27170 37552 38931 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100875.1 protein_id gnl|my_center|LOCUS_27170 38959 39687 gene locus_tag LOCUS_27180 38959 39687 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013355958.1 protein_id gnl|my_center|LOCUS_27180 39841 41814 gene locus_tag LOCUS_27190 39841 41814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 43375 41861 gene locus_tag LOCUS_27200 43375 41861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 43785 44927 gene locus_tag LOCUS_27210 43785 44927 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_27210 44946 45746 gene locus_tag LOCUS_27220 gene etfB 44946 45746 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986693.1 protein_id gnl|my_center|LOCUS_27220 45765 46904 gene locus_tag LOCUS_27230 45765 46904 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048235.1 protein_id gnl|my_center|LOCUS_27230 48594 47257 gene locus_tag LOCUS_27240 48594 47257 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944264.1 protein_id gnl|my_center|LOCUS_27240 50615 48705 gene locus_tag LOCUS_27250 50615 48705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 51202 50693 gene locus_tag LOCUS_27260 51202 50693 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_27260 51436 51684 gene locus_tag LOCUS_27270 51436 51684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 51681 51917 gene locus_tag LOCUS_27280 51681 51917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 52123 52434 gene locus_tag LOCUS_27290 gene rplU 52123 52434 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419082.1 protein_id gnl|my_center|LOCUS_27290 52434 52763 gene locus_tag LOCUS_27300 52434 52763 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016913.1 protein_id gnl|my_center|LOCUS_27300 52767 53057 gene locus_tag LOCUS_27310 gene rpmA 52767 53057 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357774.1 protein_id gnl|my_center|LOCUS_27310 53149 53637 gene locus_tag LOCUS_27320 53149 53637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 53653 54264 gene locus_tag LOCUS_27330 53653 54264 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641962.1 protein_id gnl|my_center|LOCUS_27330 54261 54695 gene locus_tag LOCUS_27340 54261 54695 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020418.1 protein_id gnl|my_center|LOCUS_27340 54724 55023 gene locus_tag LOCUS_27350 54724 55023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 55208 55612 gene locus_tag LOCUS_27360 55208 55612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 55677 55880 gene locus_tag LOCUS_27370 55677 55880 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861845.1 protein_id gnl|my_center|LOCUS_27370 55954 57234 gene locus_tag LOCUS_27380 gene obgE 55954 57234 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964572.1 protein_id gnl|my_center|LOCUS_27380 57748 57347 gene locus_tag LOCUS_27390 57748 57347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 58390 57758 gene locus_tag LOCUS_27400 58390 57758 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087456344.1 protein_id gnl|my_center|LOCUS_27400 58530 59375 gene locus_tag LOCUS_27410 gene rsmI 58530 59375 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057354.1 protein_id gnl|my_center|LOCUS_27410 59444 60817 gene locus_tag LOCUS_27420 gene murC 59444 60817 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_27420 60902 62704 gene locus_tag LOCUS_27430 60902 62704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 62831 63610 gene locus_tag LOCUS_27440 62831 63610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 63950 63651 gene locus_tag LOCUS_27450 63950 63651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 64768 64208 gene locus_tag LOCUS_27460 64768 64208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 64916 64785 gene locus_tag LOCUS_27470 64916 64785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 66406 65216 gene locus_tag LOCUS_27480 66406 65216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 68589 67228 gene locus_tag LOCUS_27490 68589 67228 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460717.1 protein_id gnl|my_center|LOCUS_27490 69614 70015 gene locus_tag LOCUS_27500 69614 70015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 70559 71206 gene locus_tag LOCUS_27510 70559 71206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 71238 71798 gene locus_tag LOCUS_27520 71238 71798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 72239 72658 gene locus_tag LOCUS_27530 72239 72658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 >Feature sequence018 994 308 gene locus_tag LOCUS_27540 994 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 1152 1436 gene locus_tag LOCUS_27550 1152 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 1542 1787 gene locus_tag LOCUS_27560 1542 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 1825 2865 gene locus_tag LOCUS_27570 1825 2865 CDS product IS30-like element ISTde2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956682.1 protein_id gnl|my_center|LOCUS_27570 4523 3093 gene locus_tag LOCUS_27580 gene pyk 4523 3093 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_27580 4746 5486 gene locus_tag LOCUS_27590 4746 5486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 7580 5538 gene locus_tag LOCUS_27600 gene metG 7580 5538 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_27600 8498 7665 gene locus_tag LOCUS_27610 8498 7665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 9028 8726 gene locus_tag LOCUS_27620 9028 8726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 10115 9009 gene locus_tag LOCUS_27630 gene mnmA 10115 9009 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_27630 10126 10332 gene locus_tag LOCUS_27640 10126 10332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 10387 12513 gene locus_tag LOCUS_27650 gene nrdD 10387 12513 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187775.1 protein_id gnl|my_center|LOCUS_27650 12571 13089 gene locus_tag LOCUS_27660 12571 13089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 13103 13621 gene locus_tag LOCUS_27670 gene nrdG 13103 13621 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148220968.1 protein_id gnl|my_center|LOCUS_27670 14259 13666 gene locus_tag LOCUS_27680 14259 13666 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944870.1 protein_id gnl|my_center|LOCUS_27680 15038 14256 gene locus_tag LOCUS_27690 15038 14256 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812246.1 protein_id gnl|my_center|LOCUS_27690 16080 15025 gene locus_tag LOCUS_27700 16080 15025 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812249.1 protein_id gnl|my_center|LOCUS_27700 16740 16099 gene locus_tag LOCUS_27710 16740 16099 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811882.1 protein_id gnl|my_center|LOCUS_27710 17464 16892 gene locus_tag LOCUS_27720 17464 16892 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_27720 18941 17565 gene locus_tag LOCUS_27730 18941 17565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 20273 19002 gene locus_tag LOCUS_27740 20273 19002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 21415 20270 gene locus_tag LOCUS_27750 21415 20270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 21987 21430 gene locus_tag LOCUS_27760 21987 21430 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669045.1 protein_id gnl|my_center|LOCUS_27760 22739 22092 gene locus_tag LOCUS_27770 22739 22092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 23580 22741 gene locus_tag LOCUS_27780 23580 22741 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048346.1 protein_id gnl|my_center|LOCUS_27780 23948 23694 gene locus_tag LOCUS_27790 23948 23694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 24031 24252 gene locus_tag LOCUS_27800 24031 24252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 25639 24620 gene locus_tag LOCUS_27810 gene ilvC 25639 24620 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081338.1 protein_id gnl|my_center|LOCUS_27810 26186 25620 gene locus_tag LOCUS_27820 gene ilvN 26186 25620 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_27820 27903 26200 gene locus_tag LOCUS_27830 gene ilvB 27903 26200 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_27830 28631 28140 gene locus_tag LOCUS_27840 28631 28140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 29028 28657 gene locus_tag LOCUS_27850 29028 28657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 29568 29053 gene locus_tag LOCUS_27860 29568 29053 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816840.1 protein_id gnl|my_center|LOCUS_27860 30053 29568 gene locus_tag LOCUS_27870 gene ilvN 30053 29568 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_27870 31694 30066 gene locus_tag LOCUS_27880 31694 30066 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_27880 32690 32148 gene locus_tag LOCUS_27890 32690 32148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 33260 32787 gene locus_tag LOCUS_27900 33260 32787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 33488 33847 gene locus_tag LOCUS_27910 33488 33847 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250445.1 protein_id gnl|my_center|LOCUS_27910 33863 34258 gene locus_tag LOCUS_27920 33863 34258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 34255 34701 gene locus_tag LOCUS_27930 34255 34701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 35074 34751 gene locus_tag LOCUS_27940 35074 34751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 35288 35055 gene locus_tag LOCUS_27950 35288 35055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 35522 35597 gene locus_tag LOCUS_t00420 35522 35597 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 35607 35691 gene locus_tag LOCUS_t00430 35607 35691 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 36456 36046 gene locus_tag LOCUS_27960 36456 36046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_27960 38215 36608 gene locus_tag LOCUS_27970 38215 36608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 39598 38273 gene locus_tag LOCUS_27980 39598 38273 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016003.1 protein_id gnl|my_center|LOCUS_27980 39790 39865 gene locus_tag LOCUS_t00440 39790 39865 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 41296 40028 gene locus_tag LOCUS_27990 41296 40028 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_27990 41596 41300 gene locus_tag LOCUS_28000 41596 41300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 41676 42497 gene locus_tag LOCUS_28010 gene amrS 41676 42497 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081949.1 protein_id gnl|my_center|LOCUS_28010 42598 43821 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaattcacgcccccgcgagggggcaaac 44290 44000 gene locus_tag LOCUS_28020 gene cas2 44290 44000 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263664.1 protein_id gnl|my_center|LOCUS_28020 45318 44293 gene locus_tag LOCUS_28030 gene cas1c 45318 44293 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_28030 45977 45315 gene locus_tag LOCUS_28040 gene cas4 45977 45315 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114935545.1 protein_id gnl|my_center|LOCUS_28040 46965 45970 gene locus_tag LOCUS_28050 gene cas7c 46965 45970 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070169.1 protein_id gnl|my_center|LOCUS_28050 48726 46969 gene locus_tag LOCUS_28060 48726 46969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 49370 48720 gene locus_tag LOCUS_28070 gene cas5c 49370 48720 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392034.1 protein_id gnl|my_center|LOCUS_28070 51686 49494 gene locus_tag LOCUS_28080 51686 49494 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392035.1 protein_id gnl|my_center|LOCUS_28080 52322 51924 gene locus_tag LOCUS_28090 52322 51924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 52633 52355 gene locus_tag LOCUS_28100 52633 52355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 53038 52682 gene locus_tag LOCUS_28110 53038 52682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28110 53481 52975 gene locus_tag LOCUS_28120 53481 52975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28120 53836 53513 gene locus_tag LOCUS_28130 53836 53513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 54317 53802 gene locus_tag LOCUS_28140 54317 53802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 55847 54465 gene locus_tag LOCUS_28150 55847 54465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 56276 55893 gene locus_tag LOCUS_28160 56276 55893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 56658 58154 gene locus_tag LOCUS_28170 56658 58154 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005646006.1 protein_id gnl|my_center|LOCUS_28170 59919 58501 gene locus_tag LOCUS_28180 59919 58501 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_28180 60555 59932 gene locus_tag LOCUS_28190 60555 59932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 61072 60638 gene locus_tag LOCUS_28200 61072 60638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272682.1 protein_id gnl|my_center|LOCUS_28200 61859 61287 gene locus_tag LOCUS_28210 61859 61287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 62254 62039 gene locus_tag LOCUS_28220 62254 62039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 62558 63313 gene locus_tag LOCUS_28230 62558 63313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 63371 64759 gene locus_tag LOCUS_28240 gene amrA 63371 64759 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393778.1 protein_id gnl|my_center|LOCUS_28240 64756 65577 gene locus_tag LOCUS_28250 gene amrS 64756 65577 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081949.1 protein_id gnl|my_center|LOCUS_28250 65627 66091 gene locus_tag LOCUS_28260 65627 66091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 66140 67168 gene locus_tag LOCUS_28270 66140 67168 CDS product DUF4065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461870.1 protein_id gnl|my_center|LOCUS_28270 69907 67241 gene locus_tag LOCUS_28280 69907 67241 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081335.1 protein_id gnl|my_center|LOCUS_28280 <71381 69897 gene locus_tag LOCUS_28290 <71381 69897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000105162.1:site-specific DNA-methyltransferase >Feature sequence019 850 653 gene locus_tag LOCUS_28300 850 653 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003063668.1 protein_id gnl|my_center|LOCUS_28300 1199 843 gene locus_tag LOCUS_28310 1199 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 1664 1867 gene locus_tag LOCUS_28320 1664 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 1941 2084 gene locus_tag LOCUS_28330 1941 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 2902 2093 gene locus_tag LOCUS_28340 2902 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 4591 3182 gene locus_tag LOCUS_28350 4591 3182 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368703.1 protein_id gnl|my_center|LOCUS_28350 5134 4625 gene locus_tag LOCUS_28360 5134 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 5514 5224 gene locus_tag LOCUS_28370 5514 5224 CDS product CD1845 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860780.1 protein_id gnl|my_center|LOCUS_28370 6003 5659 gene locus_tag LOCUS_28380 gene mobC 6003 5659 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368707.1 protein_id gnl|my_center|LOCUS_28380 6698 6000 gene locus_tag LOCUS_28390 6698 6000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 7639 6698 gene locus_tag LOCUS_28400 7639 6698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 8289 7651 gene locus_tag LOCUS_28410 8289 7651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 8831 8301 gene locus_tag LOCUS_28420 8831 8301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 9343 8966 gene locus_tag LOCUS_28430 9343 8966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 11448 9340 gene locus_tag LOCUS_28440 11448 9340 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861108.1 protein_id gnl|my_center|LOCUS_28440 12528 11503 gene locus_tag LOCUS_28450 12528 11503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 12659 12525 gene locus_tag LOCUS_28460 12659 12525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 13248 12739 gene locus_tag LOCUS_28470 13248 12739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 13398 13712 gene locus_tag LOCUS_28480 13398 13712 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813967.1 protein_id gnl|my_center|LOCUS_28480 14245 13832 gene locus_tag LOCUS_28490 gene dut 14245 13832 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970813.1 protein_id gnl|my_center|LOCUS_28490 14949 14242 gene locus_tag LOCUS_28500 14949 14242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 15190 14996 gene locus_tag LOCUS_28510 15190 14996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 15140 15340 gene locus_tag LOCUS_28520 15140 15340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 15914 15432 gene locus_tag LOCUS_28530 15914 15432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 20894 15981 gene locus_tag LOCUS_28540 20894 15981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 22141 20942 gene locus_tag LOCUS_28550 22141 20942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 22376 22131 gene locus_tag LOCUS_28560 22376 22131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 24662 22695 gene locus_tag LOCUS_28570 24662 22695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 25014 25361 gene locus_tag LOCUS_28580 25014 25361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 28158 25684 gene locus_tag LOCUS_28590 28158 25684 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_28590 28492 28058 gene locus_tag LOCUS_28600 28492 28058 CDS product PrgI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368721.1 protein_id gnl|my_center|LOCUS_28600 29078 28521 gene locus_tag LOCUS_28610 29078 28521 CDS product MT-A70 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103677717.1 protein_id gnl|my_center|LOCUS_28610 29521 29078 gene locus_tag LOCUS_28620 29521 29078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 30427 29564 gene locus_tag LOCUS_28630 30427 29564 CDS product CD0415/CD1112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610323.1 protein_id gnl|my_center|LOCUS_28630 30775 30434 gene locus_tag LOCUS_28640 30775 30434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 31046 30909 gene locus_tag LOCUS_28650 31046 30909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 33133 31289 gene locus_tag LOCUS_28660 33133 31289 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 protein_id gnl|my_center|LOCUS_28660 33600 33130 gene locus_tag LOCUS_28670 33600 33130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 34452 33652 gene locus_tag LOCUS_28680 34452 33652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 35562 34459 gene locus_tag LOCUS_28690 35562 34459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 36386 35559 gene locus_tag LOCUS_28700 36386 35559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 38424 36400 gene locus_tag LOCUS_28710 38424 36400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 39351 38455 gene locus_tag LOCUS_28720 39351 38455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 40172 39381 gene locus_tag LOCUS_28730 40172 39381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 40457 40173 gene locus_tag LOCUS_28740 40457 40173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 41459 40476 gene locus_tag LOCUS_28750 41459 40476 CDS product DUF3991 and toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368706.1 protein_id gnl|my_center|LOCUS_28750 42404 41532 gene locus_tag LOCUS_28760 42404 41532 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861119.1 protein_id gnl|my_center|LOCUS_28760 42955 42434 gene locus_tag LOCUS_28770 42955 42434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 43249 43671 gene locus_tag LOCUS_28780 43249 43671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 43854 44147 gene locus_tag LOCUS_28790 43854 44147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 44137 44460 gene locus_tag LOCUS_28800 44137 44460 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460590.1 protein_id gnl|my_center|LOCUS_28800 44523 44873 gene locus_tag LOCUS_28810 44523 44873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 45096 45021 gene locus_tag LOCUS_t00450 45096 45021 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 46625 46909 gene locus_tag LOCUS_28820 46625 46909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 46906 47289 gene locus_tag LOCUS_28830 46906 47289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 47549 47785 gene locus_tag LOCUS_28840 47549 47785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 48182 48778 gene locus_tag LOCUS_28850 48182 48778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459532.1 protein_id gnl|my_center|LOCUS_28850 48784 49467 gene locus_tag LOCUS_28860 48784 49467 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272297.1 protein_id gnl|my_center|LOCUS_28860 49467 49970 gene locus_tag LOCUS_28870 49467 49970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 50133 51590 gene locus_tag LOCUS_28880 50133 51590 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272296.1 protein_id gnl|my_center|LOCUS_28880 51587 52153 gene locus_tag LOCUS_28890 51587 52153 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255233.1 protein_id gnl|my_center|LOCUS_28890 53307 52162 gene locus_tag LOCUS_28900 53307 52162 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048169508.1 protein_id gnl|my_center|LOCUS_28900 54410 53688 gene locus_tag LOCUS_28910 54410 53688 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774590.1 protein_id gnl|my_center|LOCUS_28910 55116 54397 gene locus_tag LOCUS_28920 55116 54397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 56067 55183 gene locus_tag LOCUS_28930 56067 55183 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033580.1 protein_id gnl|my_center|LOCUS_28930 56451 58274 gene locus_tag LOCUS_28940 56451 58274 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873616.1 protein_id gnl|my_center|LOCUS_28940 59430 58306 gene locus_tag LOCUS_28950 59430 58306 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667244.1 protein_id gnl|my_center|LOCUS_28950 59928 59431 gene locus_tag LOCUS_28960 gene rimM 59928 59431 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141504.1 protein_id gnl|my_center|LOCUS_28960 60323 59922 gene locus_tag LOCUS_28970 60323 59922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 60606 60376 gene locus_tag LOCUS_28980 60606 60376 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392483.1 protein_id gnl|my_center|LOCUS_28980 60862 60623 gene locus_tag LOCUS_28990 gene rpsP 60862 60623 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965062.1 protein_id gnl|my_center|LOCUS_28990 62330 60960 gene locus_tag LOCUS_29000 gene ffh 62330 60960 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_29000 62700 62335 gene locus_tag LOCUS_29010 62700 62335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 62899 70053 gene locus_tag LOCUS_29020 62899 70053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 >Feature sequence020 923 1726 gene locus_tag LOCUS_29030 923 1726 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392692.1 protein_id gnl|my_center|LOCUS_29030 1843 3066 gene locus_tag LOCUS_29040 1843 3066 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583978.1 protein_id gnl|my_center|LOCUS_29040 3063 3548 gene locus_tag LOCUS_29050 3063 3548 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583979.1 protein_id gnl|my_center|LOCUS_29050 3576 4469 gene locus_tag LOCUS_29060 3576 4469 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064335.1 protein_id gnl|my_center|LOCUS_29060 4527 5951 gene locus_tag LOCUS_29070 4527 5951 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064334.1 protein_id gnl|my_center|LOCUS_29070 6018 7286 gene locus_tag LOCUS_29080 6018 7286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 7387 9402 gene locus_tag LOCUS_29090 7387 9402 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086713.1 protein_id gnl|my_center|LOCUS_29090 9429 10226 gene locus_tag LOCUS_29100 9429 10226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 10239 10997 gene locus_tag LOCUS_29110 10239 10997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 11031 11834 gene locus_tag LOCUS_29120 11031 11834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 11825 12589 gene locus_tag LOCUS_29130 11825 12589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 12685 13968 gene locus_tag LOCUS_29140 12685 13968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 13965 14687 gene locus_tag LOCUS_29150 13965 14687 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729573.1 protein_id gnl|my_center|LOCUS_29150 14707 14877 gene locus_tag LOCUS_29160 14707 14877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 14896 15957 gene locus_tag LOCUS_29170 14896 15957 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861704.1 protein_id gnl|my_center|LOCUS_29170 17390 16143 gene locus_tag LOCUS_29180 17390 16143 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811490.1 protein_id gnl|my_center|LOCUS_29180 18284 17391 gene locus_tag LOCUS_29190 18284 17391 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459749.1 protein_id gnl|my_center|LOCUS_29190 18830 18336 gene locus_tag LOCUS_29200 18830 18336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 19132 18827 gene locus_tag LOCUS_29210 19132 18827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 19933 19430 gene locus_tag LOCUS_29220 19933 19430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29220 20532 20029 gene locus_tag LOCUS_29230 20532 20029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29230 22093 20696 gene locus_tag LOCUS_29240 22093 20696 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_29240 23547 22288 gene locus_tag LOCUS_29250 23547 22288 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_29250 23920 24408 gene locus_tag LOCUS_29260 23920 24408 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814644.1 protein_id gnl|my_center|LOCUS_29260 24450 25646 gene locus_tag LOCUS_29270 24450 25646 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_29270 25719 26492 gene locus_tag LOCUS_29280 gene tpiA 25719 26492 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243394.1 protein_id gnl|my_center|LOCUS_29280 26700 28214 gene locus_tag LOCUS_29290 gene gpmI 26700 28214 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861866.1 protein_id gnl|my_center|LOCUS_29290 28287 29588 gene locus_tag LOCUS_29300 gene eno 28287 29588 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948030.1 protein_id gnl|my_center|LOCUS_29300 29945 30127 gene locus_tag LOCUS_29310 29945 30127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 30233 30433 gene locus_tag LOCUS_29320 30233 30433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 34193 30483 gene locus_tag LOCUS_29330 gene rpoC 34193 30483 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048356.1 protein_id gnl|my_center|LOCUS_29330 38083 34214 gene locus_tag LOCUS_29340 gene rpoB 38083 34214 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048357.1 protein_id gnl|my_center|LOCUS_29340 39366 38455 gene locus_tag LOCUS_29350 39366 38455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 39725 39435 gene locus_tag LOCUS_29360 39725 39435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 41296 39878 gene locus_tag LOCUS_29370 41296 39878 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_29370 44437 41423 gene locus_tag LOCUS_29380 44437 41423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 45421 44645 gene locus_tag LOCUS_29390 45421 44645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 45765 45442 gene locus_tag LOCUS_29400 45765 45442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 46760 45762 gene locus_tag LOCUS_29410 46760 45762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 48449 46950 gene locus_tag LOCUS_29420 gene cobA 48449 46950 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_29420 49072 48446 gene locus_tag LOCUS_29430 49072 48446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 50472 49114 gene locus_tag LOCUS_29440 gene rlmD 50472 49114 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048300.1 protein_id gnl|my_center|LOCUS_29440 52210 50810 gene locus_tag LOCUS_29450 52210 50810 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974991.1 protein_id gnl|my_center|LOCUS_29450 52832 55588 gene locus_tag LOCUS_29460 gene secA 52832 55588 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_29460 55957 57393 gene locus_tag LOCUS_29470 gene purB 55957 57393 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438353.1 protein_id gnl|my_center|LOCUS_29470 57412 58680 gene locus_tag LOCUS_29480 57412 58680 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132377852.1 protein_id gnl|my_center|LOCUS_29480 58715 59191 gene locus_tag LOCUS_29490 58715 59191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 59250 59672 gene locus_tag LOCUS_29500 59250 59672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 60228 59755 gene locus_tag LOCUS_29510 60228 59755 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291426.1 protein_id gnl|my_center|LOCUS_29510 60760 60215 gene locus_tag LOCUS_29520 60760 60215 CDS product DUF4364 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891708.1 protein_id gnl|my_center|LOCUS_29520 60750 60929 gene locus_tag LOCUS_29530 60750 60929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 60941 61765 gene locus_tag LOCUS_29540 60941 61765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 62230 61805 gene locus_tag LOCUS_29550 62230 61805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 63838 62312 gene locus_tag LOCUS_29560 gene cls 63838 62312 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966588.1 protein_id gnl|my_center|LOCUS_29560 64317 63859 gene locus_tag LOCUS_29570 64317 63859 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016060.1 protein_id gnl|my_center|LOCUS_29570 64384 64623 gene locus_tag LOCUS_29580 64384 64623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 64698 65120 gene locus_tag LOCUS_29590 64698 65120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 65113 65451 gene locus_tag LOCUS_29600 65113 65451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 66215 65454 gene locus_tag LOCUS_29610 66215 65454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 67376 66228 gene locus_tag LOCUS_29620 gene wecB 67376 66228 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243178.1 protein_id gnl|my_center|LOCUS_29620 68521 67373 gene locus_tag LOCUS_29630 68521 67373 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356585.1 protein_id gnl|my_center|LOCUS_29630 69547 68549 gene locus_tag LOCUS_29640 gene trpS 69547 68549 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165562.1 protein_id gnl|my_center|LOCUS_29640 69719 69964 gene locus_tag LOCUS_29650 69719 69964 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903691.1 protein_id gnl|my_center|LOCUS_29650 >Feature sequence021 2554 170 gene locus_tag LOCUS_29660 2554 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 3026 2535 gene locus_tag LOCUS_29670 3026 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 3997 3002 gene locus_tag LOCUS_29680 3997 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 4347 4721 gene locus_tag LOCUS_29690 4347 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 8272 4772 gene locus_tag LOCUS_29700 gene mfd 8272 4772 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243453.1 protein_id gnl|my_center|LOCUS_29700 9476 8697 gene locus_tag LOCUS_29710 9476 8697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 10445 9504 gene locus_tag LOCUS_29720 10445 9504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 11069 10572 gene locus_tag LOCUS_29730 11069 10572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 11832 11119 gene locus_tag LOCUS_29740 11832 11119 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_29740 13151 11880 gene locus_tag LOCUS_29750 13151 11880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 13502 13269 gene locus_tag LOCUS_29760 gene hfq 13502 13269 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965139.1 protein_id gnl|my_center|LOCUS_29760 14507 13566 gene locus_tag LOCUS_29770 gene miaA 14507 13566 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_29770 14834 14646 gene locus_tag LOCUS_29780 14834 14646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 16965 14953 gene locus_tag LOCUS_29790 gene mutL 16965 14953 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020571.1 protein_id gnl|my_center|LOCUS_29790 17536 17027 gene locus_tag LOCUS_29800 17536 17027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 18057 17563 gene locus_tag LOCUS_29810 18057 17563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 20914 18293 gene locus_tag LOCUS_29820 gene mutS 20914 18293 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047675.1 protein_id gnl|my_center|LOCUS_29820 22522 21113 gene locus_tag LOCUS_29830 gene miaB 22522 21113 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_29830 22758 23072 gene locus_tag LOCUS_29840 22758 23072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 23269 25353 gene locus_tag LOCUS_29850 23269 25353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 25522 26646 gene locus_tag LOCUS_29860 25522 26646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 26643 27902 gene locus_tag LOCUS_29870 26643 27902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 27923 28372 gene locus_tag LOCUS_29880 gene dut 27923 28372 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704179.1 protein_id gnl|my_center|LOCUS_29880 28436 29311 gene locus_tag LOCUS_29890 28436 29311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 29315 30178 gene locus_tag LOCUS_29900 29315 30178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 30433 30188 gene locus_tag LOCUS_29910 30433 30188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 30521 30763 gene locus_tag LOCUS_29920 30521 30763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 31005 31604 gene locus_tag LOCUS_29930 31005 31604 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392072.1 protein_id gnl|my_center|LOCUS_29930 31601 32443 gene locus_tag LOCUS_29940 gene mreC 31601 32443 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383273.1 protein_id gnl|my_center|LOCUS_29940 32575 33087 gene locus_tag LOCUS_29950 32575 33087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 33104 35389 gene locus_tag LOCUS_29960 33104 35389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 35452 36261 gene locus_tag LOCUS_29970 35452 36261 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_29970 36490 38895 gene locus_tag LOCUS_29980 gene feoB 36490 38895 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_29980 38920 39303 gene locus_tag LOCUS_29990 38920 39303 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671440.1 protein_id gnl|my_center|LOCUS_29990 39473 40270 gene locus_tag LOCUS_30000 39473 40270 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391801.1 protein_id gnl|my_center|LOCUS_30000 40529 40314 gene locus_tag LOCUS_30010 40529 40314 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459191.1 protein_id gnl|my_center|LOCUS_30010 43157 40878 gene locus_tag LOCUS_30020 gene glgP 43157 40878 CDS product glycogen/starch/alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837657.1 protein_id gnl|my_center|LOCUS_30020 44875 43370 gene locus_tag LOCUS_30030 gene malQ 44875 43370 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_30030 45335 46351 gene locus_tag LOCUS_30040 45335 46351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 46573 47349 gene locus_tag LOCUS_30050 46573 47349 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944383.1 protein_id gnl|my_center|LOCUS_30050 47377 48450 gene locus_tag LOCUS_30060 47377 48450 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942069.1 protein_id gnl|my_center|LOCUS_30060 48447 50693 gene locus_tag LOCUS_30070 48447 50693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 50987 51616 gene locus_tag LOCUS_30080 50987 51616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 51789 53858 gene locus_tag LOCUS_30090 gene recJ 51789 53858 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_30090 53959 56196 gene locus_tag LOCUS_30100 53959 56196 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_30100 56451 56251 gene locus_tag LOCUS_30110 56451 56251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 56384 56824 gene locus_tag LOCUS_30120 gene dtd 56384 56824 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426448.1 protein_id gnl|my_center|LOCUS_30120 56917 57318 gene locus_tag LOCUS_30130 56917 57318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 57345 57962 gene locus_tag LOCUS_30140 57345 57962 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_30140 58298 58056 gene locus_tag LOCUS_30150 58298 58056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 58233 58397 gene locus_tag LOCUS_30160 58233 58397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 58548 58721 gene locus_tag LOCUS_30170 58548 58721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 58718 60223 gene locus_tag LOCUS_30180 58718 60223 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924633.1 protein_id gnl|my_center|LOCUS_30180 60258 61196 gene locus_tag LOCUS_30190 60258 61196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 61224 63098 gene locus_tag LOCUS_30200 61224 63098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 63166 63984 gene locus_tag LOCUS_30210 63166 63984 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894754.1 protein_id gnl|my_center|LOCUS_30210 65765 64620 gene locus_tag LOCUS_30220 65765 64620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 66636 66286 gene locus_tag LOCUS_30230 66636 66286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 67777 66875 gene locus_tag LOCUS_30240 67777 66875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 68003 67818 gene locus_tag LOCUS_30250 68003 67818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 68522 68172 gene locus_tag LOCUS_30260 68522 68172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 68737 68662 gene locus_tag LOCUS_t00460 68737 68662 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 68851 68777 gene locus_tag LOCUS_t00470 68851 68777 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 68984 68908 gene locus_tag LOCUS_t00480 68984 68908 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 69096 69020 gene locus_tag LOCUS_t00490 69096 69020 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 69173 69100 gene locus_tag LOCUS_t00500 69173 69100 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence022 1501 611 gene locus_tag LOCUS_30270 1501 611 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814117.1 protein_id gnl|my_center|LOCUS_30270 1624 2859 gene locus_tag LOCUS_30280 1624 2859 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398755.1 protein_id gnl|my_center|LOCUS_30280 2971 3999 gene locus_tag LOCUS_30290 2971 3999 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812796.1 protein_id gnl|my_center|LOCUS_30290 4285 5067 gene locus_tag LOCUS_30300 4285 5067 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294342.1 protein_id gnl|my_center|LOCUS_30300 6080 5310 gene locus_tag LOCUS_30310 gene sigG 6080 5310 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_30310 6673 6209 gene locus_tag LOCUS_30320 6673 6209 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458846.1 protein_id gnl|my_center|LOCUS_30320 7537 6713 gene locus_tag LOCUS_30330 7537 6713 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896869.1 protein_id gnl|my_center|LOCUS_30330 7993 7550 gene locus_tag LOCUS_30340 7993 7550 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937348.1 protein_id gnl|my_center|LOCUS_30340 8549 7995 gene locus_tag LOCUS_30350 8549 7995 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458874.1 protein_id gnl|my_center|LOCUS_30350 8856 8605 gene locus_tag LOCUS_30360 8856 8605 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894075.1 protein_id gnl|my_center|LOCUS_30360 10155 8959 gene locus_tag LOCUS_30370 10155 8959 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462130.1 protein_id gnl|my_center|LOCUS_30370 10688 10185 gene locus_tag LOCUS_30380 10688 10185 CDS product DUF2004 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154327.1 protein_id gnl|my_center|LOCUS_30380 13510 10688 gene locus_tag LOCUS_30390 13510 10688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 14422 13565 gene locus_tag LOCUS_30400 gene uppP 14422 13565 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681055.1 protein_id gnl|my_center|LOCUS_30400 15341 14658 gene locus_tag LOCUS_30410 gene tepA 15341 14658 CDS product translocation-enhancing protein TepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245712.1 protein_id gnl|my_center|LOCUS_30410 15555 16151 gene locus_tag LOCUS_30420 15555 16151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 17636 16221 gene locus_tag LOCUS_30430 17636 16221 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861085.1 protein_id gnl|my_center|LOCUS_30430 18226 17633 gene locus_tag LOCUS_30440 gene coaE 18226 17633 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257771.1 protein_id gnl|my_center|LOCUS_30440 18980 18240 gene locus_tag LOCUS_30450 18980 18240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 20161 19073 gene locus_tag LOCUS_30460 20161 19073 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947984.1 protein_id gnl|my_center|LOCUS_30460 21094 20441 gene locus_tag LOCUS_30470 21094 20441 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_30470 21371 21114 gene locus_tag LOCUS_30480 21371 21114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 22448 21390 gene locus_tag LOCUS_30490 gene prfA 22448 21390 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869569.1 protein_id gnl|my_center|LOCUS_30490 22898 22689 gene locus_tag LOCUS_30500 22898 22689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 23087 23239 gene locus_tag LOCUS_30510 23087 23239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 23883 23236 gene locus_tag LOCUS_30520 23883 23236 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045791.1 protein_id gnl|my_center|LOCUS_30520 25796 23880 gene locus_tag LOCUS_30530 gene abc-f 25796 23880 CDS product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195117.1 protein_id gnl|my_center|LOCUS_30530 25874 26872 gene locus_tag LOCUS_30540 gene mtnA 25874 26872 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258877.1 protein_id gnl|my_center|LOCUS_30540 27471 26869 gene locus_tag LOCUS_30550 27471 26869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 28870 27479 gene locus_tag LOCUS_30560 28870 27479 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392358.1 protein_id gnl|my_center|LOCUS_30560 29920 28871 gene locus_tag LOCUS_30570 29920 28871 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114722.1 protein_id gnl|my_center|LOCUS_30570 31306 30563 gene locus_tag LOCUS_30580 31306 30563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 32195 31575 gene locus_tag LOCUS_30590 32195 31575 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420189.1 protein_id gnl|my_center|LOCUS_30590 32414 32220 gene locus_tag LOCUS_30600 32414 32220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 32757 32503 gene locus_tag LOCUS_30610 32757 32503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 33726 32998 gene locus_tag LOCUS_30620 33726 32998 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_30620 34532 33951 gene locus_tag LOCUS_30630 34532 33951 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948351.1 protein_id gnl|my_center|LOCUS_30630 35486 34653 gene locus_tag LOCUS_30640 35486 34653 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922568.1 protein_id gnl|my_center|LOCUS_30640 36488 35742 gene locus_tag LOCUS_30650 36488 35742 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965767.1 protein_id gnl|my_center|LOCUS_30650 37166 36972 gene locus_tag LOCUS_30660 37166 36972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 37907 37167 gene locus_tag LOCUS_30670 gene trmD 37907 37167 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829466.1 protein_id gnl|my_center|LOCUS_30670 38193 39569 gene locus_tag LOCUS_30680 38193 39569 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_30680 40301 39636 gene locus_tag LOCUS_30690 40301 39636 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478872.1 protein_id gnl|my_center|LOCUS_30690 41719 40475 gene locus_tag LOCUS_30700 41719 40475 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808136.1 protein_id gnl|my_center|LOCUS_30700 42031 43143 gene locus_tag LOCUS_30710 42031 43143 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393190.1 protein_id gnl|my_center|LOCUS_30710 43148 43780 gene locus_tag LOCUS_30720 43148 43780 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355744.1 protein_id gnl|my_center|LOCUS_30720 43789 45309 gene locus_tag LOCUS_30730 43789 45309 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437129.1 protein_id gnl|my_center|LOCUS_30730 45389 45622 gene locus_tag LOCUS_30740 45389 45622 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392374.1 protein_id gnl|my_center|LOCUS_30740 45828 45655 gene locus_tag LOCUS_30750 45828 45655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 46246 46028 gene locus_tag LOCUS_30760 46246 46028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 46169 46639 gene locus_tag LOCUS_30770 46169 46639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 46696 47055 gene locus_tag LOCUS_30780 46696 47055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 47471 47058 gene locus_tag LOCUS_30790 47471 47058 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667028.1 protein_id gnl|my_center|LOCUS_30790 47522 48928 gene locus_tag LOCUS_30800 47522 48928 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102364993.1 protein_id gnl|my_center|LOCUS_30800 48909 49721 gene locus_tag LOCUS_30810 48909 49721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 49840 51681 gene locus_tag LOCUS_30820 49840 51681 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 protein_id gnl|my_center|LOCUS_30820 51620 51979 gene locus_tag LOCUS_30830 51620 51979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 52762 52902 gene locus_tag LOCUS_30840 52762 52902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30840 52903 53748 gene locus_tag LOCUS_30850 52903 53748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 54299 53766 gene locus_tag LOCUS_30860 54299 53766 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458874.1 protein_id gnl|my_center|LOCUS_30860 54697 54359 gene locus_tag LOCUS_30870 54697 54359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 54892 55152 gene locus_tag LOCUS_30880 54892 55152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 55145 57481 gene locus_tag LOCUS_30890 55145 57481 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_30890 58064 57492 gene locus_tag LOCUS_30900 58064 57492 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943758.1 protein_id gnl|my_center|LOCUS_30900 58654 58172 gene locus_tag LOCUS_30910 58654 58172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 59153 60481 gene locus_tag LOCUS_30920 59153 60481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 60559 61491 gene locus_tag LOCUS_30930 60559 61491 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861119.1 protein_id gnl|my_center|LOCUS_30930 61791 61531 gene locus_tag LOCUS_30940 61791 61531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 61960 62385 gene locus_tag LOCUS_30950 61960 62385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 63308 62460 gene locus_tag LOCUS_30960 63308 62460 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902960.1 protein_id gnl|my_center|LOCUS_30960 63436 64434 gene locus_tag LOCUS_30970 63436 64434 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906161.1 protein_id gnl|my_center|LOCUS_30970 64441 65775 gene locus_tag LOCUS_30980 64441 65775 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861931.1 protein_id gnl|my_center|LOCUS_30980 65897 66610 gene locus_tag LOCUS_30990 65897 66610 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861321.1 protein_id gnl|my_center|LOCUS_30990 66612 67895 gene locus_tag LOCUS_31000 66612 67895 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861322.1 protein_id gnl|my_center|LOCUS_31000 67913 68119 gene locus_tag LOCUS_31010 67913 68119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 68097 68234 gene locus_tag LOCUS_31020 68097 68234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 68416 68823 gene locus_tag LOCUS_31030 68416 68823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 >Feature sequence023 696 454 gene locus_tag LOCUS_31040 696 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 1380 1180 gene locus_tag LOCUS_31050 1380 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 1525 1370 gene locus_tag LOCUS_31060 1525 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 1783 3009 gene locus_tag LOCUS_31070 1783 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 3022 3759 gene locus_tag LOCUS_31080 3022 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 3778 4470 gene locus_tag LOCUS_31090 3778 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 4495 4701 gene locus_tag LOCUS_31100 4495 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 4855 5178 gene locus_tag LOCUS_31110 4855 5178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 5232 5696 gene locus_tag LOCUS_31120 5232 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 5693 6211 gene locus_tag LOCUS_31130 5693 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 6215 6460 gene locus_tag LOCUS_31140 6215 6460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 6477 6725 gene locus_tag LOCUS_31150 6477 6725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 6718 7515 gene locus_tag LOCUS_31160 6718 7515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 7512 7826 gene locus_tag LOCUS_31170 7512 7826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 7841 9112 gene locus_tag LOCUS_31180 7841 9112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 9436 9906 gene locus_tag LOCUS_31190 9436 9906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 9903 10532 gene locus_tag LOCUS_31200 9903 10532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 10532 11290 gene locus_tag LOCUS_31210 10532 11290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 11349 12770 gene locus_tag LOCUS_31220 11349 12770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 12850 13290 gene locus_tag LOCUS_31230 12850 13290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 13300 15678 gene locus_tag LOCUS_31240 13300 15678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 15884 18010 gene locus_tag LOCUS_31250 15884 18010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 18328 18077 gene locus_tag LOCUS_31260 18328 18077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 18353 19672 gene locus_tag LOCUS_31270 18353 19672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 19686 20096 gene locus_tag LOCUS_31280 19686 20096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 20109 21125 gene locus_tag LOCUS_31290 20109 21125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926121.1 protein_id gnl|my_center|LOCUS_31290 21138 21299 gene locus_tag LOCUS_31300 21138 21299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 21296 21565 gene locus_tag LOCUS_31310 21296 21565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 23011 21647 gene locus_tag LOCUS_31320 23011 21647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 24198 23272 gene locus_tag LOCUS_31330 24198 23272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 24534 25034 gene locus_tag LOCUS_31340 24534 25034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 25031 25402 gene locus_tag LOCUS_31350 25031 25402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 26388 25624 gene locus_tag LOCUS_31360 26388 25624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 26594 26385 gene locus_tag LOCUS_31370 26594 26385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 26796 26990 gene locus_tag LOCUS_31380 26796 26990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 27020 27532 gene locus_tag LOCUS_31390 27020 27532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 27870 27568 gene locus_tag LOCUS_31400 27870 27568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 28076 27867 gene locus_tag LOCUS_31410 28076 27867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 28238 28456 gene locus_tag LOCUS_31420 28238 28456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 28464 29039 gene locus_tag LOCUS_31430 28464 29039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 29259 30074 gene locus_tag LOCUS_31440 29259 30074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 30034 31737 gene locus_tag LOCUS_31450 30034 31737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 31958 31885 gene locus_tag LOCUS_t00510 31958 31885 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 32692 32024 gene locus_tag LOCUS_31460 32692 32024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 33072 32716 gene locus_tag LOCUS_31470 gene rplT 33072 32716 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386545.1 protein_id gnl|my_center|LOCUS_31470 33306 33094 gene locus_tag LOCUS_31480 gene rpmI 33306 33094 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391268.1 protein_id gnl|my_center|LOCUS_31480 33760 33323 gene locus_tag LOCUS_31490 gene infC 33760 33323 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830789.1 protein_id gnl|my_center|LOCUS_31490 34427 35047 gene locus_tag LOCUS_31500 34427 35047 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166986.1 protein_id gnl|my_center|LOCUS_31500 35044 36060 gene locus_tag LOCUS_31510 35044 36060 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013448020.1 protein_id gnl|my_center|LOCUS_31510 41763 36430 gene locus_tag LOCUS_31520 41763 36430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 42811 41768 gene locus_tag LOCUS_31530 42811 41768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 45453 42808 gene locus_tag LOCUS_31540 45453 42808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 45991 45467 gene locus_tag LOCUS_31550 45991 45467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 48843 47446 gene locus_tag LOCUS_31560 48843 47446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 48999 49979 gene locus_tag LOCUS_31570 48999 49979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 50170 50487 gene locus_tag LOCUS_31580 50170 50487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 50487 51770 gene locus_tag LOCUS_31590 50487 51770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 51828 52088 gene locus_tag LOCUS_31600 51828 52088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 52285 54498 gene locus_tag LOCUS_31610 52285 54498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 55709 54804 gene locus_tag LOCUS_31620 55709 54804 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272323.1 protein_id gnl|my_center|LOCUS_31620 56035 55883 gene locus_tag LOCUS_31630 56035 55883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 56577 56074 gene locus_tag LOCUS_31640 gene greA 56577 56074 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830881.1 protein_id gnl|my_center|LOCUS_31640 57970 56726 gene locus_tag LOCUS_31650 57970 56726 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392227.1 protein_id gnl|my_center|LOCUS_31650 58306 59082 gene locus_tag LOCUS_31660 58306 59082 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 protein_id gnl|my_center|LOCUS_31660 59138 59929 gene locus_tag LOCUS_31670 59138 59929 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893461.1 protein_id gnl|my_center|LOCUS_31670 61772 60234 gene locus_tag LOCUS_31680 61772 60234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 64333 61778 gene locus_tag LOCUS_31690 64333 61778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 64598 65992 gene locus_tag LOCUS_31700 gene asnS 64598 65992 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948326.1 protein_id gnl|my_center|LOCUS_31700 66004 66147 gene locus_tag LOCUS_31710 66004 66147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 66144 66398 gene locus_tag LOCUS_31720 66144 66398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 66643 66464 gene locus_tag LOCUS_31730 66643 66464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31730 66848 66612 gene locus_tag LOCUS_31740 66848 66612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31740 67260 67336 gene locus_tag LOCUS_t00520 67260 67336 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 67374 67448 gene locus_tag LOCUS_t00530 67374 67448 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 67464 67539 gene locus_tag LOCUS_t00540 67464 67539 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence024 989 270 gene locus_tag LOCUS_31750 989 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 1088 1372 gene locus_tag LOCUS_31760 1088 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 1473 1718 gene locus_tag LOCUS_31770 1473 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 1778 2818 gene locus_tag LOCUS_31780 1778 2818 CDS product IS30-like element ISTde2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956682.1 protein_id gnl|my_center|LOCUS_31780 3150 2971 gene locus_tag LOCUS_31790 3150 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 5351 3990 gene locus_tag LOCUS_31800 5351 3990 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460717.1 protein_id gnl|my_center|LOCUS_31800 7703 5682 gene locus_tag LOCUS_31810 7703 5682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 7849 7721 gene locus_tag LOCUS_31820 7849 7721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 8094 7855 gene locus_tag LOCUS_31830 8094 7855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 8243 8551 gene locus_tag LOCUS_31840 8243 8551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 8553 8894 gene locus_tag LOCUS_31850 8553 8894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 9270 10472 gene locus_tag LOCUS_31860 9270 10472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 10615 11358 gene locus_tag LOCUS_31870 10615 11358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 12460 11465 gene locus_tag LOCUS_31880 12460 11465 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_31880 13575 12457 gene locus_tag LOCUS_31890 13575 12457 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_31890 15155 13572 gene locus_tag LOCUS_31900 15155 13572 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_31900 16906 15632 gene locus_tag LOCUS_31910 16906 15632 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276126.1 protein_id gnl|my_center|LOCUS_31910 17543 16968 gene locus_tag LOCUS_31920 17543 16968 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389803.1 protein_id gnl|my_center|LOCUS_31920 17977 18786 gene locus_tag LOCUS_31930 gene noc 17977 18786 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429292.1 protein_id gnl|my_center|LOCUS_31930 19130 19894 gene locus_tag LOCUS_31940 gene soj 19130 19894 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_31940 19918 20811 gene locus_tag LOCUS_31950 19918 20811 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_31950 20804 21424 gene locus_tag LOCUS_31960 20804 21424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 21475 22776 gene locus_tag LOCUS_31970 gene serS 21475 22776 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_31970 22796 23542 gene locus_tag LOCUS_31980 22796 23542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 23576 23971 gene locus_tag LOCUS_31990 gene mscL 23576 23971 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242893.1 protein_id gnl|my_center|LOCUS_31990 23972 24343 gene locus_tag LOCUS_32000 23972 24343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 24347 25060 gene locus_tag LOCUS_32010 gene rsmG 24347 25060 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048453.1 protein_id gnl|my_center|LOCUS_32010 25182 25913 gene locus_tag LOCUS_32020 gene minD 25182 25913 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869949.1 protein_id gnl|my_center|LOCUS_32020 25958 26374 gene locus_tag LOCUS_32030 25958 26374 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964912.1 protein_id gnl|my_center|LOCUS_32030 26508 27869 gene locus_tag LOCUS_32040 gene hisS 26508 27869 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036976.1 protein_id gnl|my_center|LOCUS_32040 27875 28333 gene locus_tag LOCUS_32050 27875 28333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 28373 30163 gene locus_tag LOCUS_32060 gene aspS 28373 30163 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029239.1 protein_id gnl|my_center|LOCUS_32060 30200 31423 gene locus_tag LOCUS_32070 30200 31423 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476434.1 protein_id gnl|my_center|LOCUS_32070 31695 31444 gene locus_tag LOCUS_32080 31695 31444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 31810 32028 gene locus_tag LOCUS_32090 31810 32028 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184197.1 protein_id gnl|my_center|LOCUS_32090 33245 32301 gene locus_tag LOCUS_32100 33245 32301 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643925.1 protein_id gnl|my_center|LOCUS_32100 34476 33313 gene locus_tag LOCUS_32110 34476 33313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 35335 34511 gene locus_tag LOCUS_32120 35335 34511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 36660 35332 gene locus_tag LOCUS_32130 36660 35332 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143476.1 protein_id gnl|my_center|LOCUS_32130 37722 36709 gene locus_tag LOCUS_32140 37722 36709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 39159 37726 gene locus_tag LOCUS_32150 39159 37726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 39414 39196 gene locus_tag LOCUS_32160 gene yidD 39414 39196 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229076.1 protein_id gnl|my_center|LOCUS_32160 39767 39411 gene locus_tag LOCUS_32170 39767 39411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 40036 39902 gene locus_tag LOCUS_32180 gene rpmH 40036 39902 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420485.1 protein_id gnl|my_center|LOCUS_32180 40478 41797 gene locus_tag LOCUS_32190 gene dnaA 40478 41797 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_32190 42030 43136 gene locus_tag LOCUS_32200 gene dnaN 42030 43136 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947896.1 protein_id gnl|my_center|LOCUS_32200 43149 43898 gene locus_tag LOCUS_32210 43149 43898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 43918 44133 gene locus_tag LOCUS_32220 43918 44133 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941132.1 protein_id gnl|my_center|LOCUS_32220 44130 45233 gene locus_tag LOCUS_32230 gene recF 44130 45233 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243515.1 protein_id gnl|my_center|LOCUS_32230 45235 45561 gene locus_tag LOCUS_32240 45235 45561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 45570 45833 gene locus_tag LOCUS_32250 45570 45833 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024026196.1 protein_id gnl|my_center|LOCUS_32250 45903 46310 gene locus_tag LOCUS_32260 45903 46310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 46353 48302 gene locus_tag LOCUS_32270 gene gyrB 46353 48302 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815132.1 protein_id gnl|my_center|LOCUS_32270 48315 49202 gene locus_tag LOCUS_32280 48315 49202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 49215 49670 gene locus_tag LOCUS_32290 49215 49670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 49695 52229 gene locus_tag LOCUS_32300 gene gyrA 49695 52229 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641633.1 protein_id gnl|my_center|LOCUS_32300 52275 52694 gene locus_tag LOCUS_32310 52275 52694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 52697 53152 gene locus_tag LOCUS_32320 52697 53152 CDS product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 protein_id gnl|my_center|LOCUS_32320 53564 53932 gene locus_tag LOCUS_32330 53564 53932 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693271.1 protein_id gnl|my_center|LOCUS_32330 54018 54455 gene locus_tag LOCUS_32340 gene rnhA 54018 54455 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933276.1 protein_id gnl|my_center|LOCUS_32340 54644 54471 gene locus_tag LOCUS_32350 54644 54471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 54789 55988 gene locus_tag LOCUS_32360 54789 55988 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861504.1 protein_id gnl|my_center|LOCUS_32360 56003 56548 gene locus_tag LOCUS_32370 56003 56548 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130536.1 protein_id gnl|my_center|LOCUS_32370 56719 56949 gene locus_tag LOCUS_32380 gene secG 56719 56949 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220028.1 protein_id gnl|my_center|LOCUS_32380 58749 57301 gene locus_tag LOCUS_32390 58749 57301 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949007.1 protein_id gnl|my_center|LOCUS_32390 58909 59460 gene locus_tag LOCUS_32400 58909 59460 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390032.1 protein_id gnl|my_center|LOCUS_32400 59450 60616 gene locus_tag LOCUS_32410 59450 60616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 60713 61315 gene locus_tag LOCUS_32420 60713 61315 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426696.1 protein_id gnl|my_center|LOCUS_32420 61862 61410 gene locus_tag LOCUS_32430 61862 61410 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262592.1 protein_id gnl|my_center|LOCUS_32430 62173 62009 gene locus_tag LOCUS_32440 62173 62009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 >Feature sequence025 1026 61 gene locus_tag LOCUS_32450 1026 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 1285 1737 gene locus_tag LOCUS_32460 1285 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 1829 2065 gene locus_tag LOCUS_32470 1829 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 2074 2805 gene locus_tag LOCUS_32480 2074 2805 CDS product DUF434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964914.1 protein_id gnl|my_center|LOCUS_32480 2793 4181 gene locus_tag LOCUS_32490 gene amrA 2793 4181 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393778.1 protein_id gnl|my_center|LOCUS_32490 4178 5005 gene locus_tag LOCUS_32500 gene amrS 4178 5005 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081949.1 protein_id gnl|my_center|LOCUS_32500 6296 5010 gene locus_tag LOCUS_32510 6296 5010 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461101.1 protein_id gnl|my_center|LOCUS_32510 6317 6883 gene locus_tag LOCUS_32520 6317 6883 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071130048.1 protein_id gnl|my_center|LOCUS_32520 7105 6911 gene locus_tag LOCUS_32530 7105 6911 CDS product DUF5348 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610290.1 protein_id gnl|my_center|LOCUS_32530 8845 10155 gene locus_tag LOCUS_32540 8845 10155 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016570.1 protein_id gnl|my_center|LOCUS_32540 10319 11476 gene locus_tag LOCUS_32550 10319 11476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 11457 11939 gene locus_tag LOCUS_32560 11457 11939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 12647 13048 gene locus_tag LOCUS_32570 gene mobC 12647 13048 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368707.1 protein_id gnl|my_center|LOCUS_32570 13309 13953 gene locus_tag LOCUS_32580 13309 13953 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263256.1 protein_id gnl|my_center|LOCUS_32580 14514 14915 gene locus_tag LOCUS_32590 14514 14915 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966052.1 protein_id gnl|my_center|LOCUS_32590 14941 15105 gene locus_tag LOCUS_32600 14941 15105 CDS product cysteine-rich KTR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003387697.1 protein_id gnl|my_center|LOCUS_32600 15437 15859 gene locus_tag LOCUS_32610 15437 15859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 16404 17909 gene locus_tag LOCUS_32620 16404 17909 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047851.1 protein_id gnl|my_center|LOCUS_32620 18074 19732 gene locus_tag LOCUS_32630 18074 19732 CDS product DUF3732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262047.1 protein_id gnl|my_center|LOCUS_32630 20540 19893 gene locus_tag LOCUS_32640 gene sigK 20540 19893 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047887.1 protein_id gnl|my_center|LOCUS_32640 20681 21979 gene locus_tag LOCUS_32650 20681 21979 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965885.1 protein_id gnl|my_center|LOCUS_32650 22324 22950 gene locus_tag LOCUS_32660 22324 22950 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_32660 23317 23111 gene locus_tag LOCUS_32670 23317 23111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 24009 23473 gene locus_tag LOCUS_32680 24009 23473 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_32680 24175 24351 gene locus_tag LOCUS_32690 24175 24351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 24392 25588 gene locus_tag LOCUS_32700 gene coaBC 24392 25588 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 protein_id gnl|my_center|LOCUS_32700 25622 25750 gene locus_tag LOCUS_32710 25622 25750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 25876 26328 gene locus_tag LOCUS_32720 25876 26328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 26335 27666 gene locus_tag LOCUS_32730 26335 27666 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902958.1 protein_id gnl|my_center|LOCUS_32730 28046 28228 gene locus_tag LOCUS_32740 28046 28228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 28225 28884 gene locus_tag LOCUS_32750 28225 28884 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_32750 29035 30066 gene locus_tag LOCUS_32760 29035 30066 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 protein_id gnl|my_center|LOCUS_32760 30120 30962 gene locus_tag LOCUS_32770 30120 30962 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860622.1 protein_id gnl|my_center|LOCUS_32770 31509 31033 gene locus_tag LOCUS_32780 31509 31033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 31593 32318 gene locus_tag LOCUS_32790 31593 32318 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989966.1 protein_id gnl|my_center|LOCUS_32790 32462 33517 gene locus_tag LOCUS_32800 32462 33517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 33774 34463 gene locus_tag LOCUS_32810 gene ftsE 33774 34463 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022268.1 protein_id gnl|my_center|LOCUS_32810 34447 35340 gene locus_tag LOCUS_32820 gene ftsX 34447 35340 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963820.1 protein_id gnl|my_center|LOCUS_32820 35371 35520 gene locus_tag LOCUS_32830 35371 35520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 35535 36779 gene locus_tag LOCUS_32840 35535 36779 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_32840 36920 37939 gene locus_tag LOCUS_32850 36920 37939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 38328 38038 gene locus_tag LOCUS_32860 38328 38038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 39217 38423 gene locus_tag LOCUS_32870 39217 38423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 39372 39872 gene locus_tag LOCUS_32880 39372 39872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 40368 40000 gene locus_tag LOCUS_32890 40368 40000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 41636 40398 gene locus_tag LOCUS_32900 41636 40398 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085938409.1 protein_id gnl|my_center|LOCUS_32900 41909 42601 gene locus_tag LOCUS_32910 41909 42601 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_32910 42604 44688 gene locus_tag LOCUS_32920 42604 44688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 44771 45037 gene locus_tag LOCUS_32930 44771 45037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 44919 46367 gene locus_tag LOCUS_32940 44919 46367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 46415 47104 gene locus_tag LOCUS_32950 46415 47104 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896932.1 protein_id gnl|my_center|LOCUS_32950 47304 48731 gene locus_tag LOCUS_32960 47304 48731 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814305.1 protein_id gnl|my_center|LOCUS_32960 48811 49770 gene locus_tag LOCUS_32970 48811 49770 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966170.1 protein_id gnl|my_center|LOCUS_32970 49960 50823 gene locus_tag LOCUS_32980 gene prmC 49960 50823 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_32980 50841 51341 gene locus_tag LOCUS_32990 50841 51341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 51522 52652 gene locus_tag LOCUS_33000 gene recA 51522 52652 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_33000 52652 53266 gene locus_tag LOCUS_33010 52652 53266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 53257 53493 gene locus_tag LOCUS_33020 53257 53493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 53837 55165 gene locus_tag LOCUS_33030 gene rimO 53837 55165 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_33030 55175 55699 gene locus_tag LOCUS_33040 gene pgsA 55175 55699 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362543.1 protein_id gnl|my_center|LOCUS_33040 55712 56590 gene locus_tag LOCUS_33050 55712 56590 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364453.1 protein_id gnl|my_center|LOCUS_33050 56764 56630 gene locus_tag LOCUS_33060 56764 56630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 57404 57574 gene locus_tag LOCUS_33070 57404 57574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 57588 57890 gene locus_tag LOCUS_33080 57588 57890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 58183 57887 gene locus_tag LOCUS_33090 58183 57887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33090 58671 58258 gene locus_tag LOCUS_33100 58671 58258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33100 59264 58863 gene locus_tag LOCUS_33110 59264 58863 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439566.1 protein_id gnl|my_center|LOCUS_33110 59526 60350 gene locus_tag LOCUS_33120 59526 60350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 >Feature sequence026 1095 163 gene locus_tag LOCUS_33130 1095 163 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068301.1 protein_id gnl|my_center|LOCUS_33130 1271 2212 gene locus_tag LOCUS_33140 1271 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 4006 2291 gene locus_tag LOCUS_33150 4006 2291 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104219.1 protein_id gnl|my_center|LOCUS_33150 4981 4091 gene locus_tag LOCUS_33160 4981 4091 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886481.1 protein_id gnl|my_center|LOCUS_33160 5442 4978 gene locus_tag LOCUS_33170 5442 4978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 5873 5457 gene locus_tag LOCUS_33180 5873 5457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 6073 5870 gene locus_tag LOCUS_33190 6073 5870 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263444.1 protein_id gnl|my_center|LOCUS_33190 7934 6273 gene locus_tag LOCUS_33200 gene ilvD 7934 6273 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_33200 8036 8725 gene locus_tag LOCUS_33210 8036 8725 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287585.1 protein_id gnl|my_center|LOCUS_33210 9233 9451 gene locus_tag LOCUS_33220 9233 9451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 9703 10404 gene locus_tag LOCUS_33230 gene cysE 9703 10404 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476500.1 protein_id gnl|my_center|LOCUS_33230 10643 10852 gene locus_tag LOCUS_33240 10643 10852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 10903 11565 gene locus_tag LOCUS_33250 10903 11565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 11596 13041 gene locus_tag LOCUS_33260 11596 13041 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666765.1 protein_id gnl|my_center|LOCUS_33260 15100 13124 gene locus_tag LOCUS_33270 15100 13124 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256471.1 protein_id gnl|my_center|LOCUS_33270 15420 16160 gene locus_tag LOCUS_33280 15420 16160 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 protein_id gnl|my_center|LOCUS_33280 16153 16818 gene locus_tag LOCUS_33290 16153 16818 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_33290 17009 17683 gene locus_tag LOCUS_33300 17009 17683 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_33300 17680 18909 gene locus_tag LOCUS_33310 17680 18909 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814514.1 protein_id gnl|my_center|LOCUS_33310 19106 19951 gene locus_tag LOCUS_33320 19106 19951 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_33320 19953 20894 gene locus_tag LOCUS_33330 19953 20894 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_33330 21331 21813 gene locus_tag LOCUS_33340 21331 21813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 26762 21870 gene locus_tag LOCUS_33350 26762 21870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 27379 27125 gene locus_tag LOCUS_33360 27379 27125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 28913 27381 gene locus_tag LOCUS_33370 gene hutH 28913 27381 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016650.1 protein_id gnl|my_center|LOCUS_33370 30505 28928 gene locus_tag LOCUS_33380 30505 28928 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868946.1 protein_id gnl|my_center|LOCUS_33380 30818 32467 gene locus_tag LOCUS_33390 30818 32467 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258423.1 protein_id gnl|my_center|LOCUS_33390 34161 32653 gene locus_tag LOCUS_33400 34161 32653 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027392.1 protein_id gnl|my_center|LOCUS_33400 35289 34234 gene locus_tag LOCUS_33410 35289 34234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 36070 35588 gene locus_tag LOCUS_33420 gene rlmH 36070 35588 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704775.1 protein_id gnl|my_center|LOCUS_33420 36876 36064 gene locus_tag LOCUS_33430 36876 36064 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_33430 38242 36947 gene locus_tag LOCUS_33440 38242 36947 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_33440 39722 38499 gene locus_tag LOCUS_33450 gene hemW 39722 38499 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460876.1 protein_id gnl|my_center|LOCUS_33450 40309 39800 gene locus_tag LOCUS_33460 40309 39800 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356248.1 protein_id gnl|my_center|LOCUS_33460 40651 41337 gene locus_tag LOCUS_33470 40651 41337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 41462 42904 gene locus_tag LOCUS_33480 gene proS 41462 42904 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040972.1 protein_id gnl|my_center|LOCUS_33480 43678 44208 gene locus_tag LOCUS_33490 43678 44208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 <49360 44267 gene locus_tag LOCUS_33500 <49360 44267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109597.1:Ig-like domain-containing protein >Feature sequence027 765 1424 gene locus_tag LOCUS_33510 765 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 2456 1383 gene locus_tag LOCUS_33520 2456 1383 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_33520 2756 2460 gene locus_tag LOCUS_33530 2756 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 3323 2877 gene locus_tag LOCUS_33540 3323 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272162.1 protein_id gnl|my_center|LOCUS_33540 3768 3559 gene locus_tag LOCUS_33550 3768 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 4132 3698 gene locus_tag LOCUS_33560 4132 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 4341 4129 gene locus_tag LOCUS_33570 4341 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 6259 4763 gene locus_tag LOCUS_33580 6259 4763 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022102.1 protein_id gnl|my_center|LOCUS_33580 6985 6272 gene locus_tag LOCUS_33590 6985 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107479.1 protein_id gnl|my_center|LOCUS_33590 8155 6989 gene locus_tag LOCUS_33600 8155 6989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 10909 8159 gene locus_tag LOCUS_33610 10909 8159 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022108.1 protein_id gnl|my_center|LOCUS_33610 13418 11067 gene locus_tag LOCUS_33620 13418 11067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 13779 13420 gene locus_tag LOCUS_33630 13779 13420 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459275.1 protein_id gnl|my_center|LOCUS_33630 14836 14057 gene locus_tag LOCUS_33640 14836 14057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 15262 15879 gene locus_tag LOCUS_33650 15262 15879 CDS product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057475.1 protein_id gnl|my_center|LOCUS_33650 15886 16653 gene locus_tag LOCUS_33660 15886 16653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 16672 19317 gene locus_tag LOCUS_33670 16672 19317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 19330 21735 gene locus_tag LOCUS_33680 19330 21735 CDS product N,N'-diacetylchitobiose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195978718.1 protein_id gnl|my_center|LOCUS_33680 22495 21728 gene locus_tag LOCUS_33690 22495 21728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 22689 24074 gene locus_tag LOCUS_33700 22689 24074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 24099 25055 gene locus_tag LOCUS_33710 24099 25055 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582885.1 protein_id gnl|my_center|LOCUS_33710 25055 25897 gene locus_tag LOCUS_33720 25055 25897 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389896.1 protein_id gnl|my_center|LOCUS_33720 25947 28358 gene locus_tag LOCUS_33730 25947 28358 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_33730 29036 28485 gene locus_tag LOCUS_33740 29036 28485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 29733 31220 gene locus_tag LOCUS_33750 29733 31220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 31213 33990 gene locus_tag LOCUS_33760 31213 33990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 34193 34357 gene locus_tag LOCUS_33770 34193 34357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 34405 34659 gene locus_tag LOCUS_33780 34405 34659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 34687 35589 gene locus_tag LOCUS_33790 34687 35589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 35613 38705 gene locus_tag LOCUS_33800 35613 38705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 38916 43682 gene locus_tag LOCUS_33810 38916 43682 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013853.1 protein_id gnl|my_center|LOCUS_33810 44269 44697 gene locus_tag LOCUS_33820 44269 44697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 44715 46796 gene locus_tag LOCUS_33830 44715 46796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 >Feature sequence028 1336 230 gene locus_tag LOCUS_33840 1336 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 2463 1387 gene locus_tag LOCUS_33850 2463 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 3968 2460 gene locus_tag LOCUS_33860 3968 2460 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541476.1 protein_id gnl|my_center|LOCUS_33860 4333 5196 gene locus_tag LOCUS_33870 4333 5196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 5741 5229 gene locus_tag LOCUS_33880 5741 5229 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399375.1 protein_id gnl|my_center|LOCUS_33880 6093 5725 gene locus_tag LOCUS_33890 6093 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 7184 6090 gene locus_tag LOCUS_33900 7184 6090 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_33900 7423 7181 gene locus_tag LOCUS_33910 7423 7181 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 protein_id gnl|my_center|LOCUS_33910 7770 7495 gene locus_tag LOCUS_33920 7770 7495 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814866.1 protein_id gnl|my_center|LOCUS_33920 8720 7932 gene locus_tag LOCUS_33930 gene mazG 8720 7932 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693705.1 protein_id gnl|my_center|LOCUS_33930 10758 8815 gene locus_tag LOCUS_33940 10758 8815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 11423 10788 gene locus_tag LOCUS_33950 11423 10788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 12734 11424 gene locus_tag LOCUS_33960 12734 11424 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_33960 13763 12939 gene locus_tag LOCUS_33970 13763 12939 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078448.1 protein_id gnl|my_center|LOCUS_33970 14166 13774 gene locus_tag LOCUS_33980 14166 13774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 14530 15597 gene locus_tag LOCUS_33990 gene alr 14530 15597 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817433.1 protein_id gnl|my_center|LOCUS_33990 15695 16912 gene locus_tag LOCUS_34000 15695 16912 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906398.1 protein_id gnl|my_center|LOCUS_34000 17054 17770 gene locus_tag LOCUS_34010 17054 17770 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_34010 17791 19749 gene locus_tag LOCUS_34020 17791 19749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 20584 19991 gene locus_tag LOCUS_34030 gene pth 20584 19991 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966493.1 protein_id gnl|my_center|LOCUS_34030 21739 20756 gene locus_tag LOCUS_34040 21739 20756 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359343.1 protein_id gnl|my_center|LOCUS_34040 22495 21812 gene locus_tag LOCUS_34050 22495 21812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 23187 22675 gene locus_tag LOCUS_34060 23187 22675 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896384.1 protein_id gnl|my_center|LOCUS_34060 24541 23285 gene locus_tag LOCUS_34070 24541 23285 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836905.1 protein_id gnl|my_center|LOCUS_34070 25240 24647 gene locus_tag LOCUS_34080 gene eamB 25240 24647 CDS product cysteine/O-acetylserine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368123.1 protein_id gnl|my_center|LOCUS_34080 25355 26233 gene locus_tag LOCUS_34090 25355 26233 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704467.1 protein_id gnl|my_center|LOCUS_34090 27051 26230 gene locus_tag LOCUS_34100 27051 26230 CDS product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884064.1 protein_id gnl|my_center|LOCUS_34100 27830 27048 gene locus_tag LOCUS_34110 gene proB 27830 27048 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723561.1 protein_id gnl|my_center|LOCUS_34110 28800 27997 gene locus_tag LOCUS_34120 gene proC 28800 27997 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689692.1 protein_id gnl|my_center|LOCUS_34120 28977 29348 gene locus_tag LOCUS_34130 28977 29348 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987070.1 protein_id gnl|my_center|LOCUS_34130 29345 30247 gene locus_tag LOCUS_34140 29345 30247 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_34140 30222 32147 gene locus_tag LOCUS_34150 30222 32147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 32487 33743 gene locus_tag LOCUS_34160 32487 33743 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890763.1 protein_id gnl|my_center|LOCUS_34160 33768 33899 gene locus_tag LOCUS_34170 33768 33899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 34561 34878 gene locus_tag LOCUS_34180 34561 34878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 35464 35021 gene locus_tag LOCUS_34190 gene tadA 35464 35021 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254132.1 protein_id gnl|my_center|LOCUS_34190 35631 35461 gene locus_tag LOCUS_34200 35631 35461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 35759 37633 gene locus_tag LOCUS_34210 gene mnmG 35759 37633 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_34210 37824 38723 gene locus_tag LOCUS_34220 37824 38723 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964712.1 protein_id gnl|my_center|LOCUS_34220 39021 39404 gene locus_tag LOCUS_34230 39021 39404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 39426 40850 gene locus_tag LOCUS_34240 39426 40850 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_34240 42606 41038 gene locus_tag LOCUS_34250 42606 41038 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811628.1 protein_id gnl|my_center|LOCUS_34250 43126 42830 gene locus_tag LOCUS_34260 43126 42830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 43492 45321 gene locus_tag LOCUS_34270 gene typA 43492 45321 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393394.1 protein_id gnl|my_center|LOCUS_34270 >Feature sequence029 532 302 gene locus_tag LOCUS_34280 532 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 1059 535 gene locus_tag LOCUS_34290 1059 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 1686 2036 gene locus_tag LOCUS_34300 1686 2036 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288180.1 protein_id gnl|my_center|LOCUS_34300 2049 2222 gene locus_tag LOCUS_34310 2049 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 2238 2450 gene locus_tag LOCUS_34320 2238 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34320 2610 2771 gene locus_tag LOCUS_34330 2610 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 2848 3351 gene locus_tag LOCUS_34340 2848 3351 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072993.1 protein_id gnl|my_center|LOCUS_34340 3344 4306 gene locus_tag LOCUS_34350 3344 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 4712 5146 gene locus_tag LOCUS_34360 4712 5146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 5304 5858 gene locus_tag LOCUS_34370 5304 5858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 5816 7237 gene locus_tag LOCUS_34380 5816 7237 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_34380 7588 9648 gene locus_tag LOCUS_34390 7588 9648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 11043 10030 gene locus_tag LOCUS_34400 11043 10030 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426117.1 protein_id gnl|my_center|LOCUS_34400 11522 11040 gene locus_tag LOCUS_34410 11522 11040 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_34410 12801 12127 gene locus_tag LOCUS_34420 12801 12127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 14531 12876 gene locus_tag LOCUS_34430 14531 12876 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272556.1 protein_id gnl|my_center|LOCUS_34430 15382 14528 gene locus_tag LOCUS_34440 15382 14528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 16971 15382 gene locus_tag LOCUS_34450 16971 15382 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461951.1 protein_id gnl|my_center|LOCUS_34450 17239 17084 gene locus_tag LOCUS_34460 17239 17084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 18410 17841 gene locus_tag LOCUS_34470 18410 17841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 18864 18694 gene locus_tag LOCUS_34480 18864 18694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 19580 18849 gene locus_tag LOCUS_34490 19580 18849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 20219 19620 gene locus_tag LOCUS_34500 gene lexA 20219 19620 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930693.1 protein_id gnl|my_center|LOCUS_34500 21320 20358 gene locus_tag LOCUS_34510 21320 20358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 21828 21613 gene locus_tag LOCUS_34520 21828 21613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 23093 22065 gene locus_tag LOCUS_34530 23093 22065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 24051 23107 gene locus_tag LOCUS_34540 24051 23107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 25583 24207 gene locus_tag LOCUS_34550 25583 24207 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966714.1 protein_id gnl|my_center|LOCUS_34550 27091 25667 gene locus_tag LOCUS_34560 27091 25667 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_34560 28657 27128 gene locus_tag LOCUS_34570 28657 27128 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948187.1 protein_id gnl|my_center|LOCUS_34570 30198 28792 gene locus_tag LOCUS_34580 gene hydA 30198 28792 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228420.1 protein_id gnl|my_center|LOCUS_34580 30957 30202 gene locus_tag LOCUS_34590 30957 30202 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191552.1 protein_id gnl|my_center|LOCUS_34590 32139 30973 gene locus_tag LOCUS_34600 32139 30973 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461637.1 protein_id gnl|my_center|LOCUS_34600 33298 32132 gene locus_tag LOCUS_34610 33298 32132 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108801.1 protein_id gnl|my_center|LOCUS_34610 33729 33295 gene locus_tag LOCUS_34620 33729 33295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 34973 34170 gene locus_tag LOCUS_34630 34973 34170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 35254 35397 gene locus_tag LOCUS_34640 35254 35397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 35422 35697 gene locus_tag LOCUS_34650 35422 35697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 36856 35705 gene locus_tag LOCUS_34660 36856 35705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 37530 36853 gene locus_tag LOCUS_34670 37530 36853 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_34670 37678 37824 gene locus_tag LOCUS_34680 37678 37824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 37817 38725 gene locus_tag LOCUS_34690 37817 38725 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861372.1 protein_id gnl|my_center|LOCUS_34690 38722 39681 gene locus_tag LOCUS_34700 38722 39681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 40120 39803 gene locus_tag LOCUS_34710 40120 39803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 40518 40303 gene locus_tag LOCUS_34720 40518 40303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 40701 41378 gene locus_tag LOCUS_34730 40701 41378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 >Feature sequence030 405 100 gene locus_tag LOCUS_34740 405 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 754 413 gene locus_tag LOCUS_34750 754 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34750 1108 974 gene locus_tag LOCUS_34760 1108 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 2065 1142 gene locus_tag LOCUS_34770 2065 1142 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_34770 2304 3326 gene locus_tag LOCUS_34780 gene cytR 2304 3326 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224452.1 protein_id gnl|my_center|LOCUS_34780 3345 4382 gene locus_tag LOCUS_34790 3345 4382 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_34790 4446 5612 gene locus_tag LOCUS_34800 4446 5612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 5767 7266 gene locus_tag LOCUS_34810 gene rbsA 5767 7266 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217684.1 protein_id gnl|my_center|LOCUS_34810 7263 8345 gene locus_tag LOCUS_34820 7263 8345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978822.1 protein_id gnl|my_center|LOCUS_34820 8358 9389 gene locus_tag LOCUS_34830 8358 9389 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236276.1 protein_id gnl|my_center|LOCUS_34830 9382 10368 gene locus_tag LOCUS_34840 9382 10368 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762189.1 protein_id gnl|my_center|LOCUS_34840 10744 10472 gene locus_tag LOCUS_34850 10744 10472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 11057 11704 gene locus_tag LOCUS_34860 11057 11704 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895825.1 protein_id gnl|my_center|LOCUS_34860 12011 12247 gene locus_tag LOCUS_34870 gene acpP 12011 12247 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965054.1 protein_id gnl|my_center|LOCUS_34870 12267 12686 gene locus_tag LOCUS_34880 gene accB 12267 12686 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354611.1 protein_id gnl|my_center|LOCUS_34880 12691 14082 gene locus_tag LOCUS_34890 gene accC 12691 14082 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473511.1 protein_id gnl|my_center|LOCUS_34890 14079 14933 gene locus_tag LOCUS_34900 gene accD 14079 14933 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966832.1 protein_id gnl|my_center|LOCUS_34900 14930 15754 gene locus_tag LOCUS_34910 14930 15754 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931204.1 protein_id gnl|my_center|LOCUS_34910 15751 16692 gene locus_tag LOCUS_34920 15751 16692 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_34920 16705 17640 gene locus_tag LOCUS_34930 16705 17640 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931899.1 protein_id gnl|my_center|LOCUS_34930 17631 18710 gene locus_tag LOCUS_34940 17631 18710 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966843.1 protein_id gnl|my_center|LOCUS_34940 18707 19642 gene locus_tag LOCUS_34950 gene fabD 18707 19642 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_34950 19639 20382 gene locus_tag LOCUS_34960 gene fabG 19639 20382 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_34960 20396 21637 gene locus_tag LOCUS_34970 gene fabF 20396 21637 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_34970 21642 22109 gene locus_tag LOCUS_34980 gene fabZ 21642 22109 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931959.1 protein_id gnl|my_center|LOCUS_34980 22109 22585 gene locus_tag LOCUS_34990 22109 22585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 24881 22809 gene locus_tag LOCUS_35000 gene fusA 24881 22809 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_35000 25856 25056 gene locus_tag LOCUS_35010 25856 25056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 26464 25853 gene locus_tag LOCUS_35020 gene rpoE 26464 25853 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005346.1 protein_id gnl|my_center|LOCUS_35020 27451 26480 gene locus_tag LOCUS_35030 gene dusB 27451 26480 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_35030 27570 28814 gene locus_tag LOCUS_35040 27570 28814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 28833 29135 gene locus_tag LOCUS_35050 28833 29135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 29209 29844 gene locus_tag LOCUS_35060 29209 29844 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461502.1 protein_id gnl|my_center|LOCUS_35060 30111 31346 gene locus_tag LOCUS_35070 30111 31346 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111709.1 protein_id gnl|my_center|LOCUS_35070 32081 31389 gene locus_tag LOCUS_35080 gene rplA 32081 31389 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421188.1 protein_id gnl|my_center|LOCUS_35080 32520 32095 gene locus_tag LOCUS_35090 gene rplK 32520 32095 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966425.1 protein_id gnl|my_center|LOCUS_35090 33213 32689 gene locus_tag LOCUS_35100 gene nusG 33213 32689 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_35100 33485 33219 gene locus_tag LOCUS_35110 33485 33219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 33692 33525 gene locus_tag LOCUS_35120 gene rpmG 33692 33525 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966428.1 protein_id gnl|my_center|LOCUS_35120 34200 35456 gene locus_tag LOCUS_35130 34200 35456 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869172.1 protein_id gnl|my_center|LOCUS_35130 36485 35499 gene locus_tag LOCUS_35140 36485 35499 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811663.1 protein_id gnl|my_center|LOCUS_35140 37248 36496 gene locus_tag LOCUS_35150 37248 36496 CDS product DUF4253 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016498.1 protein_id gnl|my_center|LOCUS_35150 37800 37405 gene locus_tag LOCUS_35160 37800 37405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 38837 37803 gene locus_tag LOCUS_35170 38837 37803 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963539.1 protein_id gnl|my_center|LOCUS_35170 39868 38831 gene locus_tag LOCUS_35180 39868 38831 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459800.1 protein_id gnl|my_center|LOCUS_35180 40302 39994 gene locus_tag LOCUS_35190 40302 39994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 40578 40877 gene locus_tag LOCUS_35200 40578 40877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 >Feature sequence031 279 1 gene locus_tag LOCUS_35210 279 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 527 1660 gene locus_tag LOCUS_35220 527 1660 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165992825.1 protein_id gnl|my_center|LOCUS_35220 1962 1873 gene locus_tag LOCUS_t00550 1962 1873 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2265 2122 gene locus_tag LOCUS_35230 2265 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 2252 2770 gene locus_tag LOCUS_35240 2252 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 4290 3118 gene locus_tag LOCUS_35250 4290 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 4727 4383 gene locus_tag LOCUS_35260 4727 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 6179 5700 gene locus_tag LOCUS_35270 6179 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 6905 6330 gene locus_tag LOCUS_35280 6905 6330 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966279.1 protein_id gnl|my_center|LOCUS_35280 7347 7763 gene locus_tag LOCUS_35290 gene mraZ 7347 7763 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723756.1 protein_id gnl|my_center|LOCUS_35290 7765 8700 gene locus_tag LOCUS_35300 gene rsmH 7765 8700 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949033.1 protein_id gnl|my_center|LOCUS_35300 8726 9292 gene locus_tag LOCUS_35310 8726 9292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 9418 11898 gene locus_tag LOCUS_35320 9418 11898 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_35320 12196 11933 gene locus_tag LOCUS_35330 12196 11933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 12164 13537 gene locus_tag LOCUS_35340 12164 13537 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_35340 13587 14573 gene locus_tag LOCUS_35350 gene mraY 13587 14573 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965426.1 protein_id gnl|my_center|LOCUS_35350 14754 15980 gene locus_tag LOCUS_35360 gene spoVE 14754 15980 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244810.1 protein_id gnl|my_center|LOCUS_35360 16072 17190 gene locus_tag LOCUS_35370 gene murG 16072 17190 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232184.1 protein_id gnl|my_center|LOCUS_35370 17268 17405 gene locus_tag LOCUS_35380 17268 17405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 17550 18809 gene locus_tag LOCUS_35390 gene murA 17550 18809 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927222.1 protein_id gnl|my_center|LOCUS_35390 18864 19733 gene locus_tag LOCUS_35400 18864 19733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 19880 21034 gene locus_tag LOCUS_35410 gene ftsZ 19880 21034 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386373.1 protein_id gnl|my_center|LOCUS_35410 21808 21128 gene locus_tag LOCUS_35420 21808 21128 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356156.1 protein_id gnl|my_center|LOCUS_35420 22172 21801 gene locus_tag LOCUS_35430 22172 21801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 22627 22415 gene locus_tag LOCUS_35440 22627 22415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 22715 22978 gene locus_tag LOCUS_35450 22715 22978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 24298 23039 gene locus_tag LOCUS_35460 24298 23039 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027623.1 protein_id gnl|my_center|LOCUS_35460 24493 25830 gene locus_tag LOCUS_35470 gene glnA 24493 25830 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723435.1 protein_id gnl|my_center|LOCUS_35470 25915 26700 gene locus_tag LOCUS_35480 gene dapF 25915 26700 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944873.1 protein_id gnl|my_center|LOCUS_35480 27650 27441 gene locus_tag LOCUS_35490 27650 27441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 28649 30028 gene locus_tag LOCUS_35500 28649 30028 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775553.1 protein_id gnl|my_center|LOCUS_35500 30425 30126 gene locus_tag LOCUS_35510 30425 30126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 30609 32153 gene locus_tag LOCUS_35520 30609 32153 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963421.1 protein_id gnl|my_center|LOCUS_35520 32216 33202 gene locus_tag LOCUS_35530 32216 33202 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018304962.1 protein_id gnl|my_center|LOCUS_35530 33199 33954 gene locus_tag LOCUS_35540 33199 33954 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212060.1 protein_id gnl|my_center|LOCUS_35540 34178 35656 gene locus_tag LOCUS_35550 34178 35656 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888725.1 protein_id gnl|my_center|LOCUS_35550 36679 36939 gene locus_tag LOCUS_35560 36679 36939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 36952 37317 gene locus_tag LOCUS_35570 36952 37317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 37314 37901 gene locus_tag LOCUS_35580 37314 37901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 38027 38173 gene locus_tag LOCUS_35590 38027 38173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 38222 38389 gene locus_tag LOCUS_35600 38222 38389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 >Feature sequence032 315 1172 gene locus_tag LOCUS_35610 315 1172 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860782.1 protein_id gnl|my_center|LOCUS_35610 1222 1356 gene locus_tag LOCUS_35620 1222 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 1430 2983 gene locus_tag LOCUS_35630 1430 2983 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_35630 2995 3189 gene locus_tag LOCUS_35640 2995 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 3230 3460 gene locus_tag LOCUS_35650 3230 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 3606 5414 gene locus_tag LOCUS_35660 3606 5414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 5701 5519 gene locus_tag LOCUS_35670 5701 5519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 6482 5634 gene locus_tag LOCUS_35680 6482 5634 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713634.1 protein_id gnl|my_center|LOCUS_35680 7082 6585 gene locus_tag LOCUS_35690 7082 6585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 7923 7138 gene locus_tag LOCUS_35700 7923 7138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 8801 8445 gene locus_tag LOCUS_35710 8801 8445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 9837 8869 gene locus_tag LOCUS_35720 9837 8869 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798895.1 protein_id gnl|my_center|LOCUS_35720 10421 10248 gene locus_tag LOCUS_35730 10421 10248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 10539 10769 gene locus_tag LOCUS_35740 10539 10769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 10867 12108 gene locus_tag LOCUS_35750 10867 12108 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_35750 15447 12310 gene locus_tag LOCUS_35760 15447 12310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 17217 15451 gene locus_tag LOCUS_35770 17217 15451 CDS product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268782.1 protein_id gnl|my_center|LOCUS_35770 20483 17223 gene locus_tag LOCUS_35780 20483 17223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 21645 20518 gene locus_tag LOCUS_35790 21645 20518 CDS product DUF4317 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964047.1 protein_id gnl|my_center|LOCUS_35790 23127 22147 gene locus_tag LOCUS_35800 23127 22147 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_35800 24522 23305 gene locus_tag LOCUS_35810 gene yqfD 24522 23305 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861554.1 protein_id gnl|my_center|LOCUS_35810 24808 24533 gene locus_tag LOCUS_35820 24808 24533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 25740 24865 gene locus_tag LOCUS_35830 25740 24865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 26326 25760 gene locus_tag LOCUS_35840 26326 25760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 26460 26323 gene locus_tag LOCUS_35850 26460 26323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 26678 26457 gene locus_tag LOCUS_35860 26678 26457 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974621.1 protein_id gnl|my_center|LOCUS_35860 27262 26690 gene locus_tag LOCUS_35870 27262 26690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 28196 27549 gene locus_tag LOCUS_35880 gene nth 28196 27549 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_35880 28347 29189 gene locus_tag LOCUS_35890 gene rlmA 28347 29189 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010115.1 protein_id gnl|my_center|LOCUS_35890 30085 29252 gene locus_tag LOCUS_35900 30085 29252 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764616.1 protein_id gnl|my_center|LOCUS_35900 30463 30107 gene locus_tag LOCUS_35910 30463 30107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 31175 30495 gene locus_tag LOCUS_35920 31175 30495 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358908.1 protein_id gnl|my_center|LOCUS_35920 31552 31190 gene locus_tag LOCUS_35930 31552 31190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 34914 31549 gene locus_tag LOCUS_35940 gene addB 34914 31549 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965561.1 protein_id gnl|my_center|LOCUS_35940 36551 35076 gene locus_tag LOCUS_35950 gene guaB 36551 35076 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226803.1 protein_id gnl|my_center|LOCUS_35950 36877 36620 gene locus_tag LOCUS_35960 36877 36620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 37633 36896 gene locus_tag LOCUS_35970 37633 36896 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766475.1 protein_id gnl|my_center|LOCUS_35970 38247 37636 gene locus_tag LOCUS_35980 38247 37636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 >Feature sequence033 2280 1057 gene locus_tag LOCUS_35990 2280 1057 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972561.1 protein_id gnl|my_center|LOCUS_35990 2693 3502 gene locus_tag LOCUS_36000 2693 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 4375 3581 gene locus_tag LOCUS_36010 4375 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 4905 4291 gene locus_tag LOCUS_36020 4905 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 5429 4956 gene locus_tag LOCUS_36030 5429 4956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 6076 5630 gene locus_tag LOCUS_36040 6076 5630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 7956 6556 gene locus_tag LOCUS_36050 7956 6556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 8321 7965 gene locus_tag LOCUS_36060 8321 7965 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888340.1 protein_id gnl|my_center|LOCUS_36060 8832 8485 gene locus_tag LOCUS_36070 8832 8485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 8965 9435 gene locus_tag LOCUS_36080 8965 9435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 9579 9971 gene locus_tag LOCUS_36090 9579 9971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 10096 10653 gene locus_tag LOCUS_36100 10096 10653 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390032.1 protein_id gnl|my_center|LOCUS_36100 10650 11210 gene locus_tag LOCUS_36110 10650 11210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 11657 12187 gene locus_tag LOCUS_36120 11657 12187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 12336 12773 gene locus_tag LOCUS_36130 12336 12773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 12968 13729 gene locus_tag LOCUS_36140 12968 13729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 13780 14217 gene locus_tag LOCUS_36150 13780 14217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 14343 14651 gene locus_tag LOCUS_36160 14343 14651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 14579 15127 gene locus_tag LOCUS_36170 14579 15127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 15130 16302 gene locus_tag LOCUS_36180 15130 16302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 16308 17138 gene locus_tag LOCUS_36190 16308 17138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 17141 18004 gene locus_tag LOCUS_36200 17141 18004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 18006 18641 gene locus_tag LOCUS_36210 18006 18641 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460105.1 protein_id gnl|my_center|LOCUS_36210 18677 18832 gene locus_tag LOCUS_36220 18677 18832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 18996 20432 gene locus_tag LOCUS_36230 18996 20432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 20673 21266 gene locus_tag LOCUS_36240 20673 21266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 21271 21447 gene locus_tag LOCUS_36250 21271 21447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 21560 21961 gene locus_tag LOCUS_36260 21560 21961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 21987 23450 gene locus_tag LOCUS_36270 21987 23450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 23507 23959 gene locus_tag LOCUS_36280 23507 23959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 24035 26236 gene locus_tag LOCUS_36290 24035 26236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 26255 28447 gene locus_tag LOCUS_36300 26255 28447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 28451 29119 gene locus_tag LOCUS_36310 28451 29119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 29304 30050 gene locus_tag LOCUS_36320 29304 30050 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956917.1 protein_id gnl|my_center|LOCUS_36320 30071 30397 gene locus_tag LOCUS_36330 30071 30397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 30416 31132 gene locus_tag LOCUS_36340 30416 31132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 31239 31796 gene locus_tag LOCUS_36350 31239 31796 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989391.1 protein_id gnl|my_center|LOCUS_36350 31929 32369 gene locus_tag LOCUS_36360 31929 32369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 32480 33700 gene locus_tag LOCUS_36370 32480 33700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 33724 34683 gene locus_tag LOCUS_36380 33724 34683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 34849 36198 gene locus_tag LOCUS_36390 34849 36198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 36401 36790 gene locus_tag LOCUS_36400 36401 36790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 36787 37389 gene locus_tag LOCUS_36410 36787 37389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 37436 37654 gene locus_tag LOCUS_36420 37436 37654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 >Feature sequence034 692 2509 gene locus_tag LOCUS_36430 692 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 2506 3723 gene locus_tag LOCUS_36440 2506 3723 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968693.1 protein_id gnl|my_center|LOCUS_36440 3725 4060 gene locus_tag LOCUS_36450 3725 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 4072 4644 gene locus_tag LOCUS_36460 4072 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 4676 7816 gene locus_tag LOCUS_36470 4676 7816 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968692.1 protein_id gnl|my_center|LOCUS_36470 8165 8377 gene locus_tag LOCUS_36480 8165 8377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 8374 8808 gene locus_tag LOCUS_36490 8374 8808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 9183 9629 gene locus_tag LOCUS_36500 9183 9629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272162.1 protein_id gnl|my_center|LOCUS_36500 9749 10045 gene locus_tag LOCUS_36510 9749 10045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 10049 11257 gene locus_tag LOCUS_36520 10049 11257 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_36520 11215 12648 gene locus_tag LOCUS_36530 11215 12648 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_36530 13165 13938 gene locus_tag LOCUS_36540 13165 13938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 14280 15404 gene locus_tag LOCUS_36550 14280 15404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 15394 18498 gene locus_tag LOCUS_36560 15394 18498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 18467 20941 gene locus_tag LOCUS_36570 18467 20941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 21092 21397 gene locus_tag LOCUS_36580 21092 21397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 21387 22265 gene locus_tag LOCUS_36590 21387 22265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36590 22332 22982 gene locus_tag LOCUS_36600 22332 22982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36600 22972 25638 gene locus_tag LOCUS_36610 22972 25638 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081335.1 protein_id gnl|my_center|LOCUS_36610 25936 26214 gene locus_tag LOCUS_36620 25936 26214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 26211 26645 gene locus_tag LOCUS_36630 26211 26645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 27020 27544 gene locus_tag LOCUS_36640 27020 27544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 27637 28113 gene locus_tag LOCUS_36650 27637 28113 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137628160.1 protein_id gnl|my_center|LOCUS_36650 28121 28579 gene locus_tag LOCUS_36660 28121 28579 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092482714.1 protein_id gnl|my_center|LOCUS_36660 28570 28779 gene locus_tag LOCUS_36670 28570 28779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 28689 30107 gene locus_tag LOCUS_36680 28689 30107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 30674 30432 gene locus_tag LOCUS_36690 30674 30432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 31203 30691 gene locus_tag LOCUS_36700 31203 30691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 31437 32210 gene locus_tag LOCUS_36710 31437 32210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 33951 32509 gene locus_tag LOCUS_36720 33951 32509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 34321 34638 gene locus_tag LOCUS_36730 34321 34638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 34635 34784 gene locus_tag LOCUS_36740 34635 34784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 34812 35069 gene locus_tag LOCUS_36750 34812 35069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 35624 35824 gene locus_tag LOCUS_36760 35624 35824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 35944 36240 gene locus_tag LOCUS_36770 35944 36240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 36243 37397 gene locus_tag LOCUS_36780 36243 37397 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_36780 37672 37597 gene locus_tag LOCUS_t00560 37672 37597 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence035 1027 377 gene locus_tag LOCUS_36790 1027 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 2288 1395 gene locus_tag LOCUS_36800 2288 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 3335 2577 gene locus_tag LOCUS_36810 gene yaaA 3335 2577 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458998.1 protein_id gnl|my_center|LOCUS_36810 3871 3350 gene locus_tag LOCUS_36820 3871 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 4314 3868 gene locus_tag LOCUS_36830 4314 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 4726 4316 gene locus_tag LOCUS_36840 4726 4316 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056959.1 protein_id gnl|my_center|LOCUS_36840 4813 5259 gene locus_tag LOCUS_36850 4813 5259 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940310.1 protein_id gnl|my_center|LOCUS_36850 5243 8167 gene locus_tag LOCUS_36860 5243 8167 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263395.1 protein_id gnl|my_center|LOCUS_36860 8186 10603 gene locus_tag LOCUS_36870 8186 10603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 10596 12095 gene locus_tag LOCUS_36880 10596 12095 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263393.1 protein_id gnl|my_center|LOCUS_36880 12088 12672 gene locus_tag LOCUS_36890 12088 12672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 12672 13826 gene locus_tag LOCUS_36900 12672 13826 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263394.1 protein_id gnl|my_center|LOCUS_36900 13901 14881 gene locus_tag LOCUS_36910 13901 14881 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047820.1 protein_id gnl|my_center|LOCUS_36910 15583 18291 gene locus_tag LOCUS_36920 15583 18291 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164979579.1 protein_id gnl|my_center|LOCUS_36920 18317 20125 gene locus_tag LOCUS_36930 18317 20125 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080566.1 protein_id gnl|my_center|LOCUS_36930 20265 21041 gene locus_tag LOCUS_36940 20265 21041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 21800 21138 gene locus_tag LOCUS_36950 21800 21138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 22253 22462 gene locus_tag LOCUS_36960 22253 22462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 22459 23034 gene locus_tag LOCUS_36970 22459 23034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 23289 23693 gene locus_tag LOCUS_36980 23289 23693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461992.1 protein_id gnl|my_center|LOCUS_36980 23757 24053 gene locus_tag LOCUS_36990 23757 24053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 24057 25217 gene locus_tag LOCUS_37000 24057 25217 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_37000 25222 26268 gene locus_tag LOCUS_37010 25222 26268 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_37010 27846 26302 gene locus_tag LOCUS_37020 27846 26302 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_37020 29480 27828 gene locus_tag LOCUS_37030 29480 27828 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_37030 31109 29481 gene locus_tag LOCUS_37040 31109 29481 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_37040 31463 31248 gene locus_tag LOCUS_37050 31463 31248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 31824 31651 gene locus_tag LOCUS_37060 31824 31651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 32488 32051 gene locus_tag LOCUS_37070 32488 32051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 33513 32998 gene locus_tag LOCUS_37080 33513 32998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 33931 34200 gene locus_tag LOCUS_37090 33931 34200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 34217 34510 gene locus_tag LOCUS_37100 34217 34510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 35251 34511 gene locus_tag LOCUS_37110 35251 34511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 35491 35270 gene locus_tag LOCUS_37120 35491 35270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 36538 36702 gene locus_tag LOCUS_37130 36538 36702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 37408 36710 gene locus_tag LOCUS_37140 37408 36710 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227564.1 protein_id gnl|my_center|LOCUS_37140 >Feature sequence036 381 641 gene locus_tag LOCUS_37150 381 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 1524 2747 gene locus_tag LOCUS_37160 1524 2747 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972561.1 protein_id gnl|my_center|LOCUS_37160 2971 2822 gene locus_tag LOCUS_37170 2971 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 3195 2932 gene locus_tag LOCUS_37180 3195 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37180 4071 3205 gene locus_tag LOCUS_37190 4071 3205 CDS product DUF6045 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272168.1 protein_id gnl|my_center|LOCUS_37190 4474 4136 gene locus_tag LOCUS_37200 4474 4136 CDS product DUF3852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158208705.1 protein_id gnl|my_center|LOCUS_37200 5001 4492 gene locus_tag LOCUS_37210 5001 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 12674 5067 gene locus_tag LOCUS_37220 12674 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 13557 12757 gene locus_tag LOCUS_37230 13557 12757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 14523 13687 gene locus_tag LOCUS_37240 14523 13687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 15431 14520 gene locus_tag LOCUS_37250 15431 14520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 15829 15446 gene locus_tag LOCUS_37260 15829 15446 CDS product SpoVG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272703.1 protein_id gnl|my_center|LOCUS_37260 16496 15843 gene locus_tag LOCUS_37270 16496 15843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 17270 16509 gene locus_tag LOCUS_37280 17270 16509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 17643 17260 gene locus_tag LOCUS_37290 17643 17260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 18443 17661 gene locus_tag LOCUS_37300 18443 17661 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458865.1 protein_id gnl|my_center|LOCUS_37300 18799 18479 gene locus_tag LOCUS_37310 18799 18479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272182.1 protein_id gnl|my_center|LOCUS_37310 20016 19003 gene locus_tag LOCUS_37320 20016 19003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754232.1 protein_id gnl|my_center|LOCUS_37320 21206 20016 gene locus_tag LOCUS_37330 21206 20016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 22515 21199 gene locus_tag LOCUS_37340 22515 21199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 22980 22516 gene locus_tag LOCUS_37350 22980 22516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 23975 22980 gene locus_tag LOCUS_37360 23975 22980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 25162 24050 gene locus_tag LOCUS_37370 25162 24050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 26370 25162 gene locus_tag LOCUS_37380 26370 25162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 26534 26367 gene locus_tag LOCUS_37390 26534 26367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 27360 26638 gene locus_tag LOCUS_37400 27360 26638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 28066 28839 gene locus_tag LOCUS_37410 28066 28839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 29080 29430 gene locus_tag LOCUS_37420 29080 29430 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288180.1 protein_id gnl|my_center|LOCUS_37420 29443 29973 gene locus_tag LOCUS_37430 29443 29973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 29970 30527 gene locus_tag LOCUS_37440 29970 30527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016489.1 protein_id gnl|my_center|LOCUS_37440 31746 30586 gene locus_tag LOCUS_37450 31746 30586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 32888 31743 gene locus_tag LOCUS_37460 32888 31743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 33736 32885 gene locus_tag LOCUS_37470 33736 32885 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861296.1 protein_id gnl|my_center|LOCUS_37470 34439 33723 gene locus_tag LOCUS_37480 34439 33723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 34968 34432 gene locus_tag LOCUS_37490 34968 34432 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480180.1 protein_id gnl|my_center|LOCUS_37490 35423 35635 gene locus_tag LOCUS_37500 35423 35635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 35632 36066 gene locus_tag LOCUS_37510 35632 36066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 36441 36887 gene locus_tag LOCUS_37520 36441 36887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272162.1 protein_id gnl|my_center|LOCUS_37520 >Feature sequence037 1336 296 gene locus_tag LOCUS_37530 gene plsX 1336 296 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684092.1 protein_id gnl|my_center|LOCUS_37530 2720 1416 gene locus_tag LOCUS_37540 gene trmFO 2720 1416 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813284.1 protein_id gnl|my_center|LOCUS_37540 5237 2883 gene locus_tag LOCUS_37550 gene topA 5237 2883 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813282.1 protein_id gnl|my_center|LOCUS_37550 6888 5662 gene locus_tag LOCUS_37560 gene dprA 6888 5662 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_37560 6999 8216 gene locus_tag LOCUS_37570 6999 8216 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813994.1 protein_id gnl|my_center|LOCUS_37570 8971 8213 gene locus_tag LOCUS_37580 8971 8213 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903251.1 protein_id gnl|my_center|LOCUS_37580 10731 9520 gene locus_tag LOCUS_37590 10731 9520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 11557 10844 gene locus_tag LOCUS_37600 11557 10844 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869391.1 protein_id gnl|my_center|LOCUS_37600 12392 11550 gene locus_tag LOCUS_37610 12392 11550 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262678.1 protein_id gnl|my_center|LOCUS_37610 13594 12389 gene locus_tag LOCUS_37620 13594 12389 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080270.1 protein_id gnl|my_center|LOCUS_37620 14484 13609 gene locus_tag LOCUS_37630 14484 13609 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_37630 15901 14693 gene locus_tag LOCUS_37640 15901 14693 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393979.1 protein_id gnl|my_center|LOCUS_37640 16459 17112 gene locus_tag LOCUS_37650 16459 17112 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287046.1 protein_id gnl|my_center|LOCUS_37650 17132 17899 gene locus_tag LOCUS_37660 17132 17899 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861999.1 protein_id gnl|my_center|LOCUS_37660 18343 18957 gene locus_tag LOCUS_37670 18343 18957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 18954 19472 gene locus_tag LOCUS_37680 18954 19472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 19483 20085 gene locus_tag LOCUS_37690 19483 20085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 20144 22786 gene locus_tag LOCUS_37700 20144 22786 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_37700 22791 24410 gene locus_tag LOCUS_37710 22791 24410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 24614 25621 gene locus_tag LOCUS_37720 24614 25621 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942020.1 protein_id gnl|my_center|LOCUS_37720 25880 25665 gene locus_tag LOCUS_37730 25880 25665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 26516 25944 gene locus_tag LOCUS_37740 26516 25944 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963621.1 protein_id gnl|my_center|LOCUS_37740 27694 26513 gene locus_tag LOCUS_37750 27694 26513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 28692 27691 gene locus_tag LOCUS_37760 28692 27691 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426955.1 protein_id gnl|my_center|LOCUS_37760 29507 28863 gene locus_tag LOCUS_37770 gene plsY 29507 28863 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016461.1 protein_id gnl|my_center|LOCUS_37770 30835 29510 gene locus_tag LOCUS_37780 gene der 30835 29510 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426959.1 protein_id gnl|my_center|LOCUS_37780 32370 30994 gene locus_tag LOCUS_37790 32370 30994 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903281.1 protein_id gnl|my_center|LOCUS_37790 32881 32465 gene locus_tag LOCUS_37800 32881 32465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 33129 33530 gene locus_tag LOCUS_37810 33129 33530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 33540 34793 gene locus_tag LOCUS_37820 33540 34793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 34790 35368 gene locus_tag LOCUS_37830 34790 35368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 35592 35407 gene locus_tag LOCUS_37840 35592 35407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 35798 35646 gene locus_tag LOCUS_37850 35798 35646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 >Feature sequence038 241 1524 gene locus_tag LOCUS_37860 241 1524 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886510.1 protein_id gnl|my_center|LOCUS_37860 1528 2805 gene locus_tag LOCUS_37870 1528 2805 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732282.1 protein_id gnl|my_center|LOCUS_37870 2802 3752 gene locus_tag LOCUS_37880 gene lgt 2802 3752 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924246.1 protein_id gnl|my_center|LOCUS_37880 3756 4601 gene locus_tag LOCUS_37890 gene folD 3756 4601 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_37890 7849 4640 gene locus_tag LOCUS_37900 gene carB 7849 4640 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_37900 8931 7849 gene locus_tag LOCUS_37910 gene carA 8931 7849 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429883.1 protein_id gnl|my_center|LOCUS_37910 9281 9955 gene locus_tag LOCUS_37920 9281 9955 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948011.1 protein_id gnl|my_center|LOCUS_37920 10022 10402 gene locus_tag LOCUS_37930 10022 10402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 11739 10414 gene locus_tag LOCUS_37940 11739 10414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 11889 12938 gene locus_tag LOCUS_37950 11889 12938 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_37950 13685 13206 gene locus_tag LOCUS_37960 13685 13206 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766460.1 protein_id gnl|my_center|LOCUS_37960 14785 13955 gene locus_tag LOCUS_37970 14785 13955 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_37970 15119 14883 gene locus_tag LOCUS_37980 gene spoIIID 15119 14883 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393849.1 protein_id gnl|my_center|LOCUS_37980 15235 16305 gene locus_tag LOCUS_37990 15235 16305 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_37990 17067 18416 gene locus_tag LOCUS_38000 17067 18416 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068386.1 protein_id gnl|my_center|LOCUS_38000 18436 18633 gene locus_tag LOCUS_38010 18436 18633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 18712 20004 gene locus_tag LOCUS_38020 18712 20004 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945405.1 protein_id gnl|my_center|LOCUS_38020 20028 20489 gene locus_tag LOCUS_38030 gene bcp 20028 20489 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439443.1 protein_id gnl|my_center|LOCUS_38030 21049 20579 gene locus_tag LOCUS_38040 21049 20579 CDS product LURP-one-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261892.1 protein_id gnl|my_center|LOCUS_38040 21247 21885 gene locus_tag LOCUS_38050 21247 21885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 22550 22218 gene locus_tag LOCUS_38060 22550 22218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 22667 22843 gene locus_tag LOCUS_38070 22667 22843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 22791 23150 gene locus_tag LOCUS_38080 22791 23150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 24576 23689 gene locus_tag LOCUS_38090 24576 23689 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704388.1 protein_id gnl|my_center|LOCUS_38090 24915 25580 gene locus_tag LOCUS_38100 24915 25580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 25603 26625 gene locus_tag LOCUS_38110 25603 26625 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090310.1 protein_id gnl|my_center|LOCUS_38110 26918 26736 gene locus_tag LOCUS_38120 26918 26736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 26941 27837 gene locus_tag LOCUS_38130 26941 27837 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_38130 27916 29868 gene locus_tag LOCUS_38140 27916 29868 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271912.1 protein_id gnl|my_center|LOCUS_38140 30539 29958 gene locus_tag LOCUS_38150 30539 29958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 31266 30424 gene locus_tag LOCUS_38160 31266 30424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 31860 31354 gene locus_tag LOCUS_38170 31860 31354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 33793 32582 gene locus_tag LOCUS_38180 33793 32582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 34653 33814 gene locus_tag LOCUS_38190 34653 33814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 35390 34668 gene locus_tag LOCUS_38200 35390 34668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 35637 35500 gene locus_tag LOCUS_38210 35637 35500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 >Feature sequence039 607 59 gene locus_tag LOCUS_38220 607 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 1200 3335 gene locus_tag LOCUS_38230 1200 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 3506 4228 gene locus_tag LOCUS_38240 3506 4228 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966116.1 protein_id gnl|my_center|LOCUS_38240 5558 4326 gene locus_tag LOCUS_38250 5558 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 6054 5551 gene locus_tag LOCUS_38260 6054 5551 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816021.1 protein_id gnl|my_center|LOCUS_38260 6290 6102 gene locus_tag LOCUS_38270 6290 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 6429 6950 gene locus_tag LOCUS_38280 gene ruvC 6429 6950 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256932.1 protein_id gnl|my_center|LOCUS_38280 6956 7564 gene locus_tag LOCUS_38290 gene ruvA 6956 7564 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048089.1 protein_id gnl|my_center|LOCUS_38290 7569 7901 gene locus_tag LOCUS_38300 7569 7901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 7870 8040 gene locus_tag LOCUS_38310 7870 8040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 8064 9134 gene locus_tag LOCUS_38320 gene ruvB 8064 9134 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_38320 9144 9524 gene locus_tag LOCUS_38330 9144 9524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 9782 9525 gene locus_tag LOCUS_38340 9782 9525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 9733 9906 gene locus_tag LOCUS_38350 9733 9906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 9882 10103 gene locus_tag LOCUS_38360 9882 10103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 10335 10802 gene locus_tag LOCUS_38370 10335 10802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 10827 12179 gene locus_tag LOCUS_38380 gene glmM 10827 12179 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963806.1 protein_id gnl|my_center|LOCUS_38380 12300 12911 gene locus_tag LOCUS_38390 gene sigH 12300 12911 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357363.1 protein_id gnl|my_center|LOCUS_38390 12970 13251 gene locus_tag LOCUS_38400 12970 13251 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815560.1 protein_id gnl|my_center|LOCUS_38400 13359 13577 gene locus_tag LOCUS_38410 13359 13577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38410 13546 13926 gene locus_tag LOCUS_38420 13546 13926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38420 14554 13877 gene locus_tag LOCUS_38430 14554 13877 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989471.1 protein_id gnl|my_center|LOCUS_38430 14710 14907 gene locus_tag LOCUS_38440 14710 14907 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964076.1 protein_id gnl|my_center|LOCUS_38440 16058 14949 gene locus_tag LOCUS_38450 16058 14949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 17305 16121 gene locus_tag LOCUS_38460 17305 16121 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454642.1 protein_id gnl|my_center|LOCUS_38460 17498 17298 gene locus_tag LOCUS_38470 17498 17298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 18267 17581 gene locus_tag LOCUS_38480 18267 17581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 18572 19951 gene locus_tag LOCUS_38490 18572 19951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 20397 21323 gene locus_tag LOCUS_38500 20397 21323 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136856750.1 protein_id gnl|my_center|LOCUS_38500 21345 22040 gene locus_tag LOCUS_38510 21345 22040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 22181 23830 gene locus_tag LOCUS_38520 22181 23830 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425090.1 protein_id gnl|my_center|LOCUS_38520 24097 25443 gene locus_tag LOCUS_38530 gene gdhA 24097 25443 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945505.1 protein_id gnl|my_center|LOCUS_38530 25456 26799 gene locus_tag LOCUS_38540 gene gdhA 25456 26799 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020063.1 protein_id gnl|my_center|LOCUS_38540 26945 27796 gene locus_tag LOCUS_38550 26945 27796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 27915 29543 gene locus_tag LOCUS_38560 gene ggt 27915 29543 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436720.1 protein_id gnl|my_center|LOCUS_38560 29804 30919 gene locus_tag LOCUS_38570 29804 30919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 31035 31307 gene locus_tag LOCUS_38580 31035 31307 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461031.1 protein_id gnl|my_center|LOCUS_38580 31294 31611 gene locus_tag LOCUS_38590 31294 31611 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460091.1 protein_id gnl|my_center|LOCUS_38590 31614 33101 gene locus_tag LOCUS_38600 gene glpK 31614 33101 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015864.1 protein_id gnl|my_center|LOCUS_38600 33210 34793 gene locus_tag LOCUS_38610 33210 34793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 >Feature sequence040 436 741 gene locus_tag LOCUS_38620 436 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 1252 818 gene locus_tag LOCUS_38630 1252 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 1461 1249 gene locus_tag LOCUS_38640 1461 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 1907 2443 gene locus_tag LOCUS_38650 1907 2443 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480180.1 protein_id gnl|my_center|LOCUS_38650 2436 3152 gene locus_tag LOCUS_38660 2436 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 3139 3990 gene locus_tag LOCUS_38670 3139 3990 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861296.1 protein_id gnl|my_center|LOCUS_38670 3987 5132 gene locus_tag LOCUS_38680 3987 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 5129 6298 gene locus_tag LOCUS_38690 5129 6298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 6804 6382 gene locus_tag LOCUS_38700 6804 6382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 9466 7988 gene locus_tag LOCUS_38710 9466 7988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 10001 9459 gene locus_tag LOCUS_38720 10001 9459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 10910 10173 gene locus_tag LOCUS_38730 10910 10173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 11394 10900 gene locus_tag LOCUS_38740 11394 10900 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771878.1 protein_id gnl|my_center|LOCUS_38740 12561 11539 gene locus_tag LOCUS_38750 12561 11539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 12959 12558 gene locus_tag LOCUS_38760 12959 12558 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_38760 13322 12972 gene locus_tag LOCUS_38770 13322 12972 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288180.1 protein_id gnl|my_center|LOCUS_38770 14331 13558 gene locus_tag LOCUS_38780 14331 13558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 15176 14838 gene locus_tag LOCUS_38790 15176 14838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 15466 15128 gene locus_tag LOCUS_38800 15466 15128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 16090 15695 gene locus_tag LOCUS_38810 16090 15695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 16572 16174 gene locus_tag LOCUS_38820 16572 16174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 16876 16574 gene locus_tag LOCUS_38830 16876 16574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 18506 16962 gene locus_tag LOCUS_38840 18506 16962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 19186 18503 gene locus_tag LOCUS_38850 19186 18503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 19836 19183 gene locus_tag LOCUS_38860 19836 19183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 20258 19839 gene locus_tag LOCUS_38870 20258 19839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 21001 20255 gene locus_tag LOCUS_38880 21001 20255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 21914 20991 gene locus_tag LOCUS_38890 21914 20991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 22285 21914 gene locus_tag LOCUS_38900 22285 21914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 23645 22371 gene locus_tag LOCUS_38910 23645 22371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 24337 23939 gene locus_tag LOCUS_38920 24337 23939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 24549 26087 gene locus_tag LOCUS_38930 24549 26087 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054872.1 protein_id gnl|my_center|LOCUS_38930 26525 26923 gene locus_tag LOCUS_38940 26525 26923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 27312 27680 gene locus_tag LOCUS_38950 27312 27680 CDS product cysteine-rich VLP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861105.1 protein_id gnl|my_center|LOCUS_38950 27831 27998 gene locus_tag LOCUS_38960 27831 27998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 28226 28408 gene locus_tag LOCUS_38970 28226 28408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 28405 29616 gene locus_tag LOCUS_38980 28405 29616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 29613 30740 gene locus_tag LOCUS_38990 29613 30740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 30734 31858 gene locus_tag LOCUS_39000 30734 31858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 31931 33349 gene locus_tag LOCUS_39010 31931 33349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 >Feature sequence041 360 109 gene locus_tag LOCUS_39020 360 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 1129 1470 gene locus_tag LOCUS_39030 1129 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 1484 2419 gene locus_tag LOCUS_39040 1484 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 2811 2455 gene locus_tag LOCUS_39050 gene spoVAE 2811 2455 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403640.1 protein_id gnl|my_center|LOCUS_39050 3961 2948 gene locus_tag LOCUS_39060 gene spoVAD 3961 2948 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_39060 4076 4585 gene locus_tag LOCUS_39070 gene ybeY 4076 4585 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964605.1 protein_id gnl|my_center|LOCUS_39070 4582 5361 gene locus_tag LOCUS_39080 4582 5361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 5376 5585 gene locus_tag LOCUS_39090 5376 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 5638 6531 gene locus_tag LOCUS_39100 gene era 5638 6531 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_39100 6533 6739 gene locus_tag LOCUS_39110 6533 6739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 6792 6938 gene locus_tag LOCUS_39120 6792 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 6972 7727 gene locus_tag LOCUS_39130 6972 7727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 7751 8137 gene locus_tag LOCUS_39140 7751 8137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 8865 8173 gene locus_tag LOCUS_39150 8865 8173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 9115 8927 gene locus_tag LOCUS_39160 gene rpmF 9115 8927 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545520.1 protein_id gnl|my_center|LOCUS_39160 9665 9162 gene locus_tag LOCUS_39170 9665 9162 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583304.1 protein_id gnl|my_center|LOCUS_39170 10016 10993 gene locus_tag LOCUS_39180 10016 10993 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_39180 11126 12415 gene locus_tag LOCUS_39190 gene guaA 11126 12415 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764094.1 protein_id gnl|my_center|LOCUS_39190 13144 12587 gene locus_tag LOCUS_39200 13144 12587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 13310 13498 gene locus_tag LOCUS_39210 13310 13498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395994.1 protein_id gnl|my_center|LOCUS_39210 13511 14587 gene locus_tag LOCUS_39220 13511 14587 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_39220 14591 14911 gene locus_tag LOCUS_39230 14591 14911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 14916 16073 gene locus_tag LOCUS_39240 14916 16073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 16190 16513 gene locus_tag LOCUS_39250 16190 16513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 16510 17694 gene locus_tag LOCUS_39260 16510 17694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 19280 18273 gene locus_tag LOCUS_39270 19280 18273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 20033 19299 gene locus_tag LOCUS_39280 20033 19299 CDS product PmeII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233708.1 protein_id gnl|my_center|LOCUS_39280 21216 20020 gene locus_tag LOCUS_39290 21216 20020 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166416.1 protein_id gnl|my_center|LOCUS_39290 21438 21229 gene locus_tag LOCUS_39300 21438 21229 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205227.1 protein_id gnl|my_center|LOCUS_39300 21965 21489 gene locus_tag LOCUS_39310 21965 21489 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138156903.1 protein_id gnl|my_center|LOCUS_39310 23523 22363 gene locus_tag LOCUS_39320 23523 22363 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_39320 24034 23576 gene locus_tag LOCUS_39330 24034 23576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 24223 24432 gene locus_tag LOCUS_39340 24223 24432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 24470 24952 gene locus_tag LOCUS_39350 24470 24952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 24966 25163 gene locus_tag LOCUS_39360 24966 25163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 25183 25431 gene locus_tag LOCUS_39370 25183 25431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 25437 25571 gene locus_tag LOCUS_39380 25437 25571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 25568 25936 gene locus_tag LOCUS_39390 25568 25936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 25940 26266 gene locus_tag LOCUS_39400 25940 26266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 26280 28271 gene locus_tag LOCUS_39410 26280 28271 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700554.1 protein_id gnl|my_center|LOCUS_39410 28268 28564 gene locus_tag LOCUS_39420 28268 28564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 28578 29738 gene locus_tag LOCUS_39430 28578 29738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 29738 30304 gene locus_tag LOCUS_39440 29738 30304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 31055 30297 gene locus_tag LOCUS_39450 31055 30297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 31388 31089 gene locus_tag LOCUS_39460 31388 31089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 31597 32172 gene locus_tag LOCUS_39470 31597 32172 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 protein_id gnl|my_center|LOCUS_39470 32187 32591 gene locus_tag LOCUS_39480 32187 32591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 >Feature sequence042 1 76 gene locus_tag LOCUS_t00570 1 76 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1374 2414 gene locus_tag LOCUS_39490 1374 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 6474 2416 gene locus_tag LOCUS_39500 6474 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 7686 6775 gene locus_tag LOCUS_39510 7686 6775 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775527.1 protein_id gnl|my_center|LOCUS_39510 7927 8002 gene locus_tag LOCUS_t00580 7927 8002 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 8222 8854 gene locus_tag LOCUS_39520 8222 8854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 8954 9133 gene locus_tag LOCUS_39530 8954 9133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 9432 10535 gene locus_tag LOCUS_39540 9432 10535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 10535 11650 gene locus_tag LOCUS_39550 10535 11650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 11726 13063 gene locus_tag LOCUS_39560 11726 13063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 13063 14076 gene locus_tag LOCUS_39570 13063 14076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 14069 14827 gene locus_tag LOCUS_39580 14069 14827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 14828 15811 gene locus_tag LOCUS_39590 14828 15811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 15804 17000 gene locus_tag LOCUS_39600 15804 17000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 17272 17592 gene locus_tag LOCUS_39610 17272 17592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272182.1 protein_id gnl|my_center|LOCUS_39610 17601 18413 gene locus_tag LOCUS_39620 17601 18413 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458865.1 protein_id gnl|my_center|LOCUS_39620 18430 18936 gene locus_tag LOCUS_39630 18430 18936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 18926 19684 gene locus_tag LOCUS_39640 18926 19684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 19688 20350 gene locus_tag LOCUS_39650 19688 20350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 20364 20723 gene locus_tag LOCUS_39660 20364 20723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 20737 21645 gene locus_tag LOCUS_39670 20737 21645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 21642 22469 gene locus_tag LOCUS_39680 21642 22469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 22590 23165 gene locus_tag LOCUS_39690 22590 23165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 23241 28436 gene locus_tag LOCUS_39700 23241 28436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 28526 28858 gene locus_tag LOCUS_39710 28526 28858 CDS product DUF3852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158208705.1 protein_id gnl|my_center|LOCUS_39710 28939 29403 gene locus_tag LOCUS_39720 28939 29403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 29458 30324 gene locus_tag LOCUS_39730 29458 30324 CDS product DUF6045 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272168.1 protein_id gnl|my_center|LOCUS_39730 30340 31032 gene locus_tag LOCUS_39740 30340 31032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 31184 32083 gene locus_tag LOCUS_39750 31184 32083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39750 >Feature sequence043 1 144 gene locus_tag LOCUS_39760 1 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 144 779 gene locus_tag LOCUS_39770 144 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 1741 962 gene locus_tag LOCUS_39780 1741 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 2986 2258 gene locus_tag LOCUS_39790 2986 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 5195 2979 gene locus_tag LOCUS_39800 5195 2979 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986642.1 protein_id gnl|my_center|LOCUS_39800 6052 5192 gene locus_tag LOCUS_39810 6052 5192 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986643.1 protein_id gnl|my_center|LOCUS_39810 7589 6120 gene locus_tag LOCUS_39820 7589 6120 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986504.1 protein_id gnl|my_center|LOCUS_39820 8238 7567 gene locus_tag LOCUS_39830 8238 7567 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986505.1 protein_id gnl|my_center|LOCUS_39830 9267 8494 gene locus_tag LOCUS_39840 9267 8494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 9711 11207 gene locus_tag LOCUS_39850 9711 11207 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005646006.1 protein_id gnl|my_center|LOCUS_39850 11962 11486 gene locus_tag LOCUS_39860 11962 11486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 12197 12078 gene locus_tag LOCUS_39870 12197 12078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 12378 13403 gene locus_tag LOCUS_39880 12378 13403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 14112 13477 gene locus_tag LOCUS_39890 14112 13477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 14525 15793 gene locus_tag LOCUS_39900 14525 15793 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987123.1 protein_id gnl|my_center|LOCUS_39900 15838 16140 gene locus_tag LOCUS_39910 15838 16140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 16556 17746 gene locus_tag LOCUS_39920 16556 17746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 18010 17885 gene locus_tag LOCUS_39930 18010 17885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 18961 18167 gene locus_tag LOCUS_39940 18961 18167 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_39940 19901 18954 gene locus_tag LOCUS_39950 19901 18954 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549276.1 protein_id gnl|my_center|LOCUS_39950 21035 19986 gene locus_tag LOCUS_39960 21035 19986 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_39960 21240 21395 gene locus_tag LOCUS_39970 21240 21395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 21529 22365 gene locus_tag LOCUS_39980 21529 22365 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811658.1 protein_id gnl|my_center|LOCUS_39980 22355 23269 gene locus_tag LOCUS_39990 22355 23269 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459799.1 protein_id gnl|my_center|LOCUS_39990 23253 23675 gene locus_tag LOCUS_40000 23253 23675 CDS product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889078.1 protein_id gnl|my_center|LOCUS_40000 23837 23679 gene locus_tag LOCUS_40010 23837 23679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 24330 26165 gene locus_tag LOCUS_40020 gene glmS 24330 26165 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_40020 26197 27093 gene locus_tag LOCUS_40030 26197 27093 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964063.1 protein_id gnl|my_center|LOCUS_40030 27534 28955 gene locus_tag LOCUS_40040 gene purF 27534 28955 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461475.1 protein_id gnl|my_center|LOCUS_40040 29567 29151 gene locus_tag LOCUS_40050 29567 29151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40050 29853 29530 gene locus_tag LOCUS_40060 29853 29530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40060 30235 29879 gene locus_tag LOCUS_40070 30235 29879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 >Feature sequence044 944 615 gene locus_tag LOCUS_40080 944 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 2385 1675 gene locus_tag LOCUS_40090 2385 1675 CDS product DUF434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964914.1 protein_id gnl|my_center|LOCUS_40090 2830 2423 gene locus_tag LOCUS_40100 2830 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 3750 4085 gene locus_tag LOCUS_40110 3750 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 4190 4546 gene locus_tag LOCUS_40120 4190 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 4664 4807 gene locus_tag LOCUS_40130 4664 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 5155 4901 gene locus_tag LOCUS_40140 5155 4901 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272734.1 protein_id gnl|my_center|LOCUS_40140 7006 5159 gene locus_tag LOCUS_40150 7006 5159 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458826.1 protein_id gnl|my_center|LOCUS_40150 8447 7011 gene locus_tag LOCUS_40160 8447 7011 CDS product DUF3991 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461990.1 protein_id gnl|my_center|LOCUS_40160 9155 8526 gene locus_tag LOCUS_40170 9155 8526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 9462 9265 gene locus_tag LOCUS_40180 9462 9265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 10153 9428 gene locus_tag LOCUS_40190 10153 9428 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460586.1 protein_id gnl|my_center|LOCUS_40190 10343 10146 gene locus_tag LOCUS_40200 10343 10146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 13112 10398 gene locus_tag LOCUS_40210 gene mobP3 13112 10398 CDS product MobP3 family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461899.1 protein_id gnl|my_center|LOCUS_40210 13540 13133 gene locus_tag LOCUS_40220 13540 13133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461992.1 protein_id gnl|my_center|LOCUS_40220 14682 13951 gene locus_tag LOCUS_40230 14682 13951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 15311 14760 gene locus_tag LOCUS_40240 15311 14760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 16151 15447 gene locus_tag LOCUS_40250 16151 15447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 16423 16148 gene locus_tag LOCUS_40260 16423 16148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 17682 16444 gene locus_tag LOCUS_40270 17682 16444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 18538 17696 gene locus_tag LOCUS_40280 18538 17696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 19617 18562 gene locus_tag LOCUS_40290 19617 18562 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272687.1 protein_id gnl|my_center|LOCUS_40290 21013 19610 gene locus_tag LOCUS_40300 21013 19610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 21819 21031 gene locus_tag LOCUS_40310 21819 21031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 21922 23424 gene locus_tag LOCUS_40320 21922 23424 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057658.1 protein_id gnl|my_center|LOCUS_40320 23411 23806 gene locus_tag LOCUS_40330 23411 23806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 25646 23808 gene locus_tag LOCUS_40340 25646 23808 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272164.1 protein_id gnl|my_center|LOCUS_40340 26217 25639 gene locus_tag LOCUS_40350 26217 25639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272165.1 protein_id gnl|my_center|LOCUS_40350 26600 26229 gene locus_tag LOCUS_40360 26600 26229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 26866 26597 gene locus_tag LOCUS_40370 26866 26597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458841.1 protein_id gnl|my_center|LOCUS_40370 27261 26911 gene locus_tag LOCUS_40380 27261 26911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 >Feature sequence045 188 556 gene locus_tag LOCUS_40390 188 556 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637688.1 protein_id gnl|my_center|LOCUS_40390 572 718 gene locus_tag LOCUS_40400 572 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 745 2916 gene locus_tag LOCUS_40410 745 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 2807 4345 gene locus_tag LOCUS_40420 2807 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40420 4414 4770 gene locus_tag LOCUS_40430 4414 4770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 4803 5714 gene locus_tag LOCUS_40440 4803 5714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 5717 6010 gene locus_tag LOCUS_40450 5717 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 6000 6401 gene locus_tag LOCUS_40460 6000 6401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 6398 6757 gene locus_tag LOCUS_40470 6398 6757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 6758 7255 gene locus_tag LOCUS_40480 6758 7255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 7271 9010 gene locus_tag LOCUS_40490 7271 9010 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_40490 9003 10880 gene locus_tag LOCUS_40500 9003 10880 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_40500 10911 12290 gene locus_tag LOCUS_40510 10911 12290 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016772.1 protein_id gnl|my_center|LOCUS_40510 12287 12913 gene locus_tag LOCUS_40520 12287 12913 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_40520 13368 14549 gene locus_tag LOCUS_40530 13368 14549 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815222.1 protein_id gnl|my_center|LOCUS_40530 15160 14963 gene locus_tag LOCUS_40540 15160 14963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 15475 15663 gene locus_tag LOCUS_40550 15475 15663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 15755 17260 gene locus_tag LOCUS_40560 15755 17260 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047851.1 protein_id gnl|my_center|LOCUS_40560 17720 17565 gene locus_tag LOCUS_40570 17720 17565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 18638 17793 gene locus_tag LOCUS_40580 18638 17793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 21261 18694 gene locus_tag LOCUS_40590 21261 18694 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814229.1 protein_id gnl|my_center|LOCUS_40590 21940 21275 gene locus_tag LOCUS_40600 21940 21275 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861403.1 protein_id gnl|my_center|LOCUS_40600 22987 22208 gene locus_tag LOCUS_40610 22987 22208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 23819 23115 gene locus_tag LOCUS_40620 23819 23115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 24403 23894 gene locus_tag LOCUS_40630 24403 23894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 25452 24418 gene locus_tag LOCUS_40640 25452 24418 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861402.1 protein_id gnl|my_center|LOCUS_40640 26132 25449 gene locus_tag LOCUS_40650 26132 25449 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861401.1 protein_id gnl|my_center|LOCUS_40650 26510 26151 gene locus_tag LOCUS_40660 26510 26151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 >Feature sequence046 282 728 gene locus_tag LOCUS_40670 282 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272162.1 protein_id gnl|my_center|LOCUS_40670 749 3226 gene locus_tag LOCUS_40680 749 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 3637 3299 gene locus_tag LOCUS_40690 gene mazF 3637 3299 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392535.1 protein_id gnl|my_center|LOCUS_40690 3894 3631 gene locus_tag LOCUS_40700 3894 3631 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887061.1 protein_id gnl|my_center|LOCUS_40700 3979 5466 gene locus_tag LOCUS_40710 3979 5466 CDS product DUF3991 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461990.1 protein_id gnl|my_center|LOCUS_40710 5521 7368 gene locus_tag LOCUS_40720 5521 7368 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458826.1 protein_id gnl|my_center|LOCUS_40720 8410 8000 gene locus_tag LOCUS_40730 8410 8000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 9824 8454 gene locus_tag LOCUS_40740 9824 8454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 10008 10592 gene locus_tag LOCUS_40750 10008 10592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 10903 10583 gene locus_tag LOCUS_40760 10903 10583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 10967 11911 gene locus_tag LOCUS_40770 10967 11911 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_40770 12856 11966 gene locus_tag LOCUS_40780 12856 11966 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288251.1 protein_id gnl|my_center|LOCUS_40780 13019 16090 gene locus_tag LOCUS_40790 13019 16090 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288607.1 protein_id gnl|my_center|LOCUS_40790 16119 17483 gene locus_tag LOCUS_40800 16119 17483 CDS product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459600.1 protein_id gnl|my_center|LOCUS_40800 17514 18650 gene locus_tag LOCUS_40810 gene galK 17514 18650 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456582.1 protein_id gnl|my_center|LOCUS_40810 18665 20155 gene locus_tag LOCUS_40820 gene galT 18665 20155 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_40820 20159 21163 gene locus_tag LOCUS_40830 gene galE 20159 21163 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870152.1 protein_id gnl|my_center|LOCUS_40830 22607 21345 gene locus_tag LOCUS_40840 22607 21345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 22804 23082 gene locus_tag LOCUS_40850 22804 23082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 23104 23985 gene locus_tag LOCUS_40860 23104 23985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 24093 25052 gene locus_tag LOCUS_40870 24093 25052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 25128 26435 gene locus_tag LOCUS_40880 25128 26435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 >Feature sequence047 716 162 gene locus_tag LOCUS_40890 716 162 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052021.1 protein_id gnl|my_center|LOCUS_40890 894 1214 gene locus_tag LOCUS_40900 894 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 1201 1488 gene locus_tag LOCUS_40910 1201 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 1728 1525 gene locus_tag LOCUS_40920 1728 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 1834 2184 gene locus_tag LOCUS_40930 1834 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 2185 2451 gene locus_tag LOCUS_40940 2185 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458841.1 protein_id gnl|my_center|LOCUS_40940 2448 3026 gene locus_tag LOCUS_40950 2448 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272165.1 protein_id gnl|my_center|LOCUS_40950 3019 4851 gene locus_tag LOCUS_40960 3019 4851 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272164.1 protein_id gnl|my_center|LOCUS_40960 5058 4861 gene locus_tag LOCUS_40970 5058 4861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813910.1 protein_id gnl|my_center|LOCUS_40970 6563 5058 gene locus_tag LOCUS_40980 6563 5058 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057658.1 protein_id gnl|my_center|LOCUS_40980 6657 8066 gene locus_tag LOCUS_40990 6657 8066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 8059 9117 gene locus_tag LOCUS_41000 8059 9117 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272687.1 protein_id gnl|my_center|LOCUS_41000 9136 9975 gene locus_tag LOCUS_41010 9136 9975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 9984 10820 gene locus_tag LOCUS_41020 9984 10820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 10833 11105 gene locus_tag LOCUS_41030 10833 11105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 11095 12102 gene locus_tag LOCUS_41040 11095 12102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 12489 12896 gene locus_tag LOCUS_41050 12489 12896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272682.1 protein_id gnl|my_center|LOCUS_41050 12917 14950 gene locus_tag LOCUS_41060 gene mobP3 12917 14950 CDS product MobP3 family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461899.1 protein_id gnl|my_center|LOCUS_41060 15005 15217 gene locus_tag LOCUS_41070 15005 15217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 15195 15920 gene locus_tag LOCUS_41080 15195 15920 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460586.1 protein_id gnl|my_center|LOCUS_41080 15987 17426 gene locus_tag LOCUS_41090 15987 17426 CDS product DUF3991 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461990.1 protein_id gnl|my_center|LOCUS_41090 17427 18974 gene locus_tag LOCUS_41100 17427 18974 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458826.1 protein_id gnl|my_center|LOCUS_41100 19689 21572 gene locus_tag LOCUS_41110 gene ltrA 19689 21572 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002335621.1 protein_id gnl|my_center|LOCUS_41110 21710 21973 gene locus_tag LOCUS_41120 21710 21973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 21975 22229 gene locus_tag LOCUS_41130 21975 22229 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272734.1 protein_id gnl|my_center|LOCUS_41130 >Feature sequence048 950 60 gene locus_tag LOCUS_41140 950 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 1464 901 gene locus_tag LOCUS_41150 1464 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 2368 1481 gene locus_tag LOCUS_41160 2368 1481 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_41160 3232 2384 gene locus_tag LOCUS_41170 3232 2384 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775210.1 protein_id gnl|my_center|LOCUS_41170 3607 4599 gene locus_tag LOCUS_41180 3607 4599 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546223.1 protein_id gnl|my_center|LOCUS_41180 4643 5227 gene locus_tag LOCUS_41190 4643 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 5356 5811 gene locus_tag LOCUS_41200 5356 5811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 5827 6576 gene locus_tag LOCUS_41210 5827 6576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 7407 6775 gene locus_tag LOCUS_41220 7407 6775 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211251.1 protein_id gnl|my_center|LOCUS_41220 8660 7446 gene locus_tag LOCUS_41230 8660 7446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 8734 8898 gene locus_tag LOCUS_41240 8734 8898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 9124 10350 gene locus_tag LOCUS_41250 9124 10350 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085938409.1 protein_id gnl|my_center|LOCUS_41250 10800 10504 gene locus_tag LOCUS_41260 10800 10504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41260 11132 10872 gene locus_tag LOCUS_41270 11132 10872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41270 11287 11156 gene locus_tag LOCUS_41280 11287 11156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41280 11683 11531 gene locus_tag LOCUS_41290 11683 11531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 12733 11768 gene locus_tag LOCUS_41300 12733 11768 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814609.1 protein_id gnl|my_center|LOCUS_41300 13206 12766 gene locus_tag LOCUS_41310 13206 12766 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906378.1 protein_id gnl|my_center|LOCUS_41310 14887 14405 gene locus_tag LOCUS_41320 14887 14405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 16177 15248 gene locus_tag LOCUS_41330 16177 15248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 16273 17778 gene locus_tag LOCUS_41340 16273 17778 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057658.1 protein_id gnl|my_center|LOCUS_41340 17778 18173 gene locus_tag LOCUS_41350 17778 18173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 20013 18175 gene locus_tag LOCUS_41360 20013 18175 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272164.1 protein_id gnl|my_center|LOCUS_41360 20584 20006 gene locus_tag LOCUS_41370 20584 20006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272165.1 protein_id gnl|my_center|LOCUS_41370 20892 20581 gene locus_tag LOCUS_41380 20892 20581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458841.1 protein_id gnl|my_center|LOCUS_41380 21270 20953 gene locus_tag LOCUS_41390 21270 20953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 21446 22000 gene locus_tag LOCUS_41400 21446 22000 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744266.1 protein_id gnl|my_center|LOCUS_41400 >Feature sequence049 1961 669 gene locus_tag LOCUS_41410 1961 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 2331 1972 gene locus_tag LOCUS_41420 2331 1972 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888340.1 protein_id gnl|my_center|LOCUS_41420 3065 2664 gene locus_tag LOCUS_41430 3065 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 3931 3596 gene locus_tag LOCUS_41440 3931 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41440 4332 3931 gene locus_tag LOCUS_41450 4332 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41450 4523 4870 gene locus_tag LOCUS_41460 4523 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 5076 4876 gene locus_tag LOCUS_41470 5076 4876 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423163.1 protein_id gnl|my_center|LOCUS_41470 5217 5080 gene locus_tag LOCUS_41480 5217 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 5747 5247 gene locus_tag LOCUS_41490 5747 5247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 6114 5818 gene locus_tag LOCUS_41500 6114 5818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 5998 6717 gene locus_tag LOCUS_41510 5998 6717 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948727.1 protein_id gnl|my_center|LOCUS_41510 6714 8018 gene locus_tag LOCUS_41520 6714 8018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 8011 8214 gene locus_tag LOCUS_41530 8011 8214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435950.1 protein_id gnl|my_center|LOCUS_41530 8217 8753 gene locus_tag LOCUS_41540 8217 8753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41540 8735 8962 gene locus_tag LOCUS_41550 8735 8962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 8987 9385 gene locus_tag LOCUS_41560 8987 9385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 9413 10093 gene locus_tag LOCUS_41570 9413 10093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 10147 10902 gene locus_tag LOCUS_41580 10147 10902 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815081.1 protein_id gnl|my_center|LOCUS_41580 11004 11576 gene locus_tag LOCUS_41590 11004 11576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 11704 12597 gene locus_tag LOCUS_41600 11704 12597 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459749.1 protein_id gnl|my_center|LOCUS_41600 12598 13845 gene locus_tag LOCUS_41610 12598 13845 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811490.1 protein_id gnl|my_center|LOCUS_41610 14266 15087 gene locus_tag LOCUS_41620 14266 15087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 15084 15848 gene locus_tag LOCUS_41630 15084 15848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 15880 16368 gene locus_tag LOCUS_41640 15880 16368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 16372 18021 gene locus_tag LOCUS_41650 16372 18021 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301254.1 protein_id gnl|my_center|LOCUS_41650 18036 18788 gene locus_tag LOCUS_41660 18036 18788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 19316 18906 gene locus_tag LOCUS_41670 19316 18906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 20769 19510 gene locus_tag LOCUS_41680 20769 19510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 >Feature sequence050 2308 356 gene locus_tag LOCUS_41690 2308 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 3053 2295 gene locus_tag LOCUS_41700 3053 2295 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860752.1 protein_id gnl|my_center|LOCUS_41700 4143 3133 gene locus_tag LOCUS_41710 4143 3133 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986639.1 protein_id gnl|my_center|LOCUS_41710 4805 4140 gene locus_tag LOCUS_41720 4805 4140 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986640.1 protein_id gnl|my_center|LOCUS_41720 5398 4901 gene locus_tag LOCUS_41730 5398 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 5789 5556 gene locus_tag LOCUS_41740 5789 5556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 6188 6520 gene locus_tag LOCUS_41750 6188 6520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 6505 6714 gene locus_tag LOCUS_41760 6505 6714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 6707 7873 gene locus_tag LOCUS_41770 6707 7873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_41770 8229 8663 gene locus_tag LOCUS_41780 8229 8663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 8994 8578 gene locus_tag LOCUS_41790 8994 8578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41790 9621 9169 gene locus_tag LOCUS_41800 9621 9169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 9922 10338 gene locus_tag LOCUS_41810 9922 10338 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358712.1 protein_id gnl|my_center|LOCUS_41810 10355 12268 gene locus_tag LOCUS_41820 10355 12268 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903247.1 protein_id gnl|my_center|LOCUS_41820 12302 13519 gene locus_tag LOCUS_41830 12302 13519 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_41830 14191 13586 gene locus_tag LOCUS_41840 14191 13586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41840 14818 14195 gene locus_tag LOCUS_41850 14818 14195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41850 16933 15647 gene locus_tag LOCUS_41860 16933 15647 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775456.1 protein_id gnl|my_center|LOCUS_41860 17845 17534 gene locus_tag LOCUS_41870 17845 17534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 20199 18016 gene locus_tag LOCUS_41880 20199 18016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 >Feature sequence051 271 708 gene locus_tag LOCUS_41890 271 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 740 1816 gene locus_tag LOCUS_41900 740 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 1926 2123 gene locus_tag LOCUS_41910 1926 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 2169 2828 gene locus_tag LOCUS_41920 2169 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 2864 3448 gene locus_tag LOCUS_41930 2864 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 3619 4020 gene locus_tag LOCUS_41940 3619 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 4046 5515 gene locus_tag LOCUS_41950 4046 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 5568 6017 gene locus_tag LOCUS_41960 5568 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 6092 8290 gene locus_tag LOCUS_41970 6092 8290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 8309 10501 gene locus_tag LOCUS_41980 8309 10501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 10505 11173 gene locus_tag LOCUS_41990 10505 11173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 11356 12309 gene locus_tag LOCUS_42000 11356 12309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 12423 12926 gene locus_tag LOCUS_42010 12423 12926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 13023 13556 gene locus_tag LOCUS_42020 13023 13556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 13550 14224 gene locus_tag LOCUS_42030 13550 14224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 14229 14588 gene locus_tag LOCUS_42040 14229 14588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 14618 15337 gene locus_tag LOCUS_42050 14618 15337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 15381 16178 gene locus_tag LOCUS_42060 15381 16178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 16265 16675 gene locus_tag LOCUS_42070 16265 16675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 16730 17299 gene locus_tag LOCUS_42080 16730 17299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 17269 17565 gene locus_tag LOCUS_42090 17269 17565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 17632 18591 gene locus_tag LOCUS_42100 17632 18591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 18658 19152 gene locus_tag LOCUS_42110 18658 19152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 19324 19713 gene locus_tag LOCUS_42120 19324 19713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 >Feature sequence052 625 410 gene locus_tag LOCUS_42130 625 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 981 589 gene locus_tag LOCUS_42140 981 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 1319 978 gene locus_tag LOCUS_42150 1319 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 2719 1316 gene locus_tag LOCUS_42160 2719 1316 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113850176.1 protein_id gnl|my_center|LOCUS_42160 2996 2700 gene locus_tag LOCUS_42170 2996 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 5648 3252 gene locus_tag LOCUS_42180 5648 3252 CDS product VapE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714181.1 protein_id gnl|my_center|LOCUS_42180 6188 5673 gene locus_tag LOCUS_42190 6188 5673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 6400 6185 gene locus_tag LOCUS_42200 6400 6185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 6587 6393 gene locus_tag LOCUS_42210 6587 6393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 7138 6593 gene locus_tag LOCUS_42220 7138 6593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310171.1 protein_id gnl|my_center|LOCUS_42220 7320 7135 gene locus_tag LOCUS_42230 7320 7135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 7822 7271 gene locus_tag LOCUS_42240 7822 7271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 8036 7791 gene locus_tag LOCUS_42250 8036 7791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 8659 8087 gene locus_tag LOCUS_42260 8659 8087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 8857 9219 gene locus_tag LOCUS_42270 8857 9219 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888340.1 protein_id gnl|my_center|LOCUS_42270 9230 11476 gene locus_tag LOCUS_42280 9230 11476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 13465 11714 gene locus_tag LOCUS_42290 13465 11714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 13935 14396 gene locus_tag LOCUS_42300 13935 14396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 15190 14516 gene locus_tag LOCUS_42310 15190 14516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 15416 15240 gene locus_tag LOCUS_42320 15416 15240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42320 16430 15681 gene locus_tag LOCUS_42330 16430 15681 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109255.1 protein_id gnl|my_center|LOCUS_42330 16897 18567 gene locus_tag LOCUS_42340 16897 18567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 19188 18760 gene locus_tag LOCUS_42350 19188 18760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 19425 19213 gene locus_tag LOCUS_42360 19425 19213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 >Feature sequence053 <1 1025 gene locus_tag LOCUS_42370 <1 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007052464.1:WYL domain-containing protein 1688 1497 gene locus_tag LOCUS_42380 1688 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 2058 1777 gene locus_tag LOCUS_42390 2058 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 3021 2170 gene locus_tag LOCUS_42400 3021 2170 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700996.1 protein_id gnl|my_center|LOCUS_42400 3627 3079 gene locus_tag LOCUS_42410 3627 3079 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_42410 3722 4810 gene locus_tag LOCUS_42420 3722 4810 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483463.1 protein_id gnl|my_center|LOCUS_42420 5073 5567 gene locus_tag LOCUS_42430 gene purE 5073 5567 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393549.1 protein_id gnl|my_center|LOCUS_42430 5567 6250 gene locus_tag LOCUS_42440 5567 6250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 6292 7002 gene locus_tag LOCUS_42450 6292 7002 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047943.1 protein_id gnl|my_center|LOCUS_42450 7015 8439 gene locus_tag LOCUS_42460 7015 8439 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764741.1 protein_id gnl|my_center|LOCUS_42460 8574 9638 gene locus_tag LOCUS_42470 gene purM 8574 9638 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081095.1 protein_id gnl|my_center|LOCUS_42470 9683 10282 gene locus_tag LOCUS_42480 gene purN 9683 10282 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_42480 10279 11010 gene locus_tag LOCUS_42490 10279 11010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42490 11014 11721 gene locus_tag LOCUS_42500 11014 11721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 11737 12942 gene locus_tag LOCUS_42510 11737 12942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 12955 13575 gene locus_tag LOCUS_42520 12955 13575 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017089.1 protein_id gnl|my_center|LOCUS_42520 13691 14803 gene locus_tag LOCUS_42530 13691 14803 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_42530 14820 15404 gene locus_tag LOCUS_42540 14820 15404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 15420 16676 gene locus_tag LOCUS_42550 gene purD 15420 16676 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_42550 17119 17241 gene locus_tag LOCUS_42560 17119 17241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 17244 17432 gene locus_tag LOCUS_42570 17244 17432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42570 17489 17719 gene locus_tag LOCUS_42580 17489 17719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42580 18056 18661 gene locus_tag LOCUS_42590 18056 18661 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679463.1 protein_id gnl|my_center|LOCUS_42590 18658 19221 gene locus_tag LOCUS_42600 18658 19221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 >Feature sequence054 884 432 gene locus_tag LOCUS_42610 884 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 1394 996 gene locus_tag LOCUS_42620 1394 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 3213 1858 gene locus_tag LOCUS_42630 3213 1858 CDS product two-component system sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861185.1 protein_id gnl|my_center|LOCUS_42630 3863 3204 gene locus_tag LOCUS_42640 3863 3204 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405372.1 protein_id gnl|my_center|LOCUS_42640 4304 3945 gene locus_tag LOCUS_42650 4304 3945 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288776.1 protein_id gnl|my_center|LOCUS_42650 4975 4322 gene locus_tag LOCUS_42660 4975 4322 CDS product lantibiotic immunity ABC transporter MutG family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861184.1 protein_id gnl|my_center|LOCUS_42660 5798 5067 gene locus_tag LOCUS_42670 5798 5067 CDS product lantibiotic immunity ABC transporter MutE/EpiE family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002265408.1 protein_id gnl|my_center|LOCUS_42670 6505 5798 gene locus_tag LOCUS_42680 6505 5798 CDS product lantibiotic protection ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986262.1 protein_id gnl|my_center|LOCUS_42680 6999 6643 gene locus_tag LOCUS_42690 6999 6643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 7230 7018 gene locus_tag LOCUS_42700 7230 7018 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885335.1 protein_id gnl|my_center|LOCUS_42700 7560 7387 gene locus_tag LOCUS_42710 7560 7387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 8071 7655 gene locus_tag LOCUS_42720 8071 7655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 8697 8056 gene locus_tag LOCUS_42730 8697 8056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42730 9009 8698 gene locus_tag LOCUS_42740 9009 8698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42740 9384 10349 gene locus_tag LOCUS_42750 9384 10349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 10443 10958 gene locus_tag LOCUS_42760 10443 10958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 10974 12476 gene locus_tag LOCUS_42770 10974 12476 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903081.1 protein_id gnl|my_center|LOCUS_42770 12480 13832 gene locus_tag LOCUS_42780 12480 13832 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072542480.1 protein_id gnl|my_center|LOCUS_42780 13863 14972 gene locus_tag LOCUS_42790 13863 14972 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287288.1 protein_id gnl|my_center|LOCUS_42790 15024 16139 gene locus_tag LOCUS_42800 15024 16139 CDS product SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390206.1 protein_id gnl|my_center|LOCUS_42800 16144 16929 gene locus_tag LOCUS_42810 16144 16929 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002325086.1 protein_id gnl|my_center|LOCUS_42810 17162 16950 gene locus_tag LOCUS_42820 17162 16950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 17496 17134 gene locus_tag LOCUS_42830 17496 17134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42830 17495 17659 gene locus_tag LOCUS_42840 17495 17659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 >Feature sequence055 <1 932 gene locus_tag LOCUS_42850 <1 932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011101749.1:major capsid protein 2076 910 gene locus_tag LOCUS_42860 2076 910 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_42860 2216 2461 gene locus_tag LOCUS_42870 2216 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 3679 2696 gene locus_tag LOCUS_42880 3679 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 3826 4026 gene locus_tag LOCUS_42890 3826 4026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 4030 4194 gene locus_tag LOCUS_42900 4030 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 4198 4539 gene locus_tag LOCUS_42910 4198 4539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 4560 4826 gene locus_tag LOCUS_42920 4560 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 4823 7162 gene locus_tag LOCUS_42930 4823 7162 CDS product VapE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714181.1 protein_id gnl|my_center|LOCUS_42930 7308 7628 gene locus_tag LOCUS_42940 7308 7628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 7741 8121 gene locus_tag LOCUS_42950 7741 8121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 8118 8738 gene locus_tag LOCUS_42960 8118 8738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 9037 9861 gene locus_tag LOCUS_42970 9037 9861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 9861 10433 gene locus_tag LOCUS_42980 9861 10433 CDS product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861030.1 protein_id gnl|my_center|LOCUS_42980 10426 10785 gene locus_tag LOCUS_42990 10426 10785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 10785 13148 gene locus_tag LOCUS_43000 10785 13148 CDS product tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861036.1 protein_id gnl|my_center|LOCUS_43000 13410 14033 gene locus_tag LOCUS_43010 13410 14033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 14030 14377 gene locus_tag LOCUS_43020 14030 14377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 14469 14738 gene locus_tag LOCUS_43030 14469 14738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024889622.1 protein_id gnl|my_center|LOCUS_43030 15101 15592 gene locus_tag LOCUS_43040 15101 15592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 15589 16137 gene locus_tag LOCUS_43050 15589 16137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 16440 16838 gene locus_tag LOCUS_43060 16440 16838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 16832 17200 gene locus_tag LOCUS_43070 16832 17200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 17200 17769 gene locus_tag LOCUS_43080 17200 17769 CDS product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861030.1 protein_id gnl|my_center|LOCUS_43080 >Feature sequence056 984 46 gene locus_tag LOCUS_43090 984 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 1488 1889 gene locus_tag LOCUS_43100 1488 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 2184 2567 gene locus_tag LOCUS_43110 2184 2567 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723032.1 protein_id gnl|my_center|LOCUS_43110 2564 5128 gene locus_tag LOCUS_43120 2564 5128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 5729 5355 gene locus_tag LOCUS_43130 5729 5355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 6601 6377 gene locus_tag LOCUS_43140 6601 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 7031 6588 gene locus_tag LOCUS_43150 7031 6588 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324547.1 protein_id gnl|my_center|LOCUS_43150 7711 7067 gene locus_tag LOCUS_43160 7711 7067 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002455915.1 protein_id gnl|my_center|LOCUS_43160 8574 7708 gene locus_tag LOCUS_43170 8574 7708 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_43170 8953 8576 gene locus_tag LOCUS_43180 8953 8576 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_43180 9484 9344 gene locus_tag LOCUS_43190 9484 9344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 11417 9579 gene locus_tag LOCUS_43200 11417 9579 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 protein_id gnl|my_center|LOCUS_43200 11877 11404 gene locus_tag LOCUS_43210 11877 11404 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368727.1 protein_id gnl|my_center|LOCUS_43210 12604 11918 gene locus_tag LOCUS_43220 12604 11918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 13655 12612 gene locus_tag LOCUS_43230 13655 12612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 14026 13685 gene locus_tag LOCUS_43240 14026 13685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 15714 14356 gene locus_tag LOCUS_43250 15714 14356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 15933 16277 gene locus_tag LOCUS_43260 15933 16277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 >Feature sequence057 269 424 gene locus_tag LOCUS_43270 269 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43270 536 2125 gene locus_tag LOCUS_43280 536 2125 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461951.1 protein_id gnl|my_center|LOCUS_43280 2125 2985 gene locus_tag LOCUS_43290 2125 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 2982 4610 gene locus_tag LOCUS_43300 2982 4610 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272556.1 protein_id gnl|my_center|LOCUS_43300 4624 5373 gene locus_tag LOCUS_43310 4624 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 5681 5526 gene locus_tag LOCUS_43320 5681 5526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 5972 6667 gene locus_tag LOCUS_43330 5972 6667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 6727 7044 gene locus_tag LOCUS_43340 6727 7044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 7031 7912 gene locus_tag LOCUS_43350 7031 7912 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016475763.1 protein_id gnl|my_center|LOCUS_43350 8245 8739 gene locus_tag LOCUS_43360 8245 8739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 8874 9626 gene locus_tag LOCUS_43370 8874 9626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 9924 10418 gene locus_tag LOCUS_43380 9924 10418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 10451 11359 gene locus_tag LOCUS_43390 10451 11359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 12753 11647 gene locus_tag LOCUS_43400 12753 11647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 14544 12868 gene locus_tag LOCUS_43410 14544 12868 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_43410 >Feature sequence058 <1 609 gene locus_tag LOCUS_43420 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964914.1:DUF434 domain-containing protein 606 1292 gene locus_tag LOCUS_43430 606 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 1292 3193 gene locus_tag LOCUS_43440 1292 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 3242 4201 gene locus_tag LOCUS_43450 3242 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 4262 5035 gene locus_tag LOCUS_43460 4262 5035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 5290 5060 gene locus_tag LOCUS_43470 5290 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 6892 5393 gene locus_tag LOCUS_43480 6892 5393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 8543 7164 gene locus_tag LOCUS_43490 8543 7164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 8908 8552 gene locus_tag LOCUS_43500 8908 8552 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888340.1 protein_id gnl|my_center|LOCUS_43500 9357 9046 gene locus_tag LOCUS_43510 9357 9046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 9613 9344 gene locus_tag LOCUS_43520 9613 9344 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272532.1 protein_id gnl|my_center|LOCUS_43520 10073 9726 gene locus_tag LOCUS_43530 10073 9726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 10206 10655 gene locus_tag LOCUS_43540 10206 10655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 10797 11354 gene locus_tag LOCUS_43550 10797 11354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 11351 12259 gene locus_tag LOCUS_43560 11351 12259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 12171 12353 gene locus_tag LOCUS_43570 12171 12353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 12410 12970 gene locus_tag LOCUS_43580 12410 12970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 12967 13473 gene locus_tag LOCUS_43590 12967 13473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 >Feature sequence059 310 1461 gene locus_tag LOCUS_43600 310 1461 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_43600 2671 7044 gene locus_tag LOCUS_43610 2671 7044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 7745 8896 gene locus_tag LOCUS_43620 7745 8896 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_43620 10505 9225 gene locus_tag LOCUS_43630 10505 9225 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287015.1 protein_id gnl|my_center|LOCUS_43630 10707 10507 gene locus_tag LOCUS_43640 10707 10507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 10975 10841 gene locus_tag LOCUS_43650 10975 10841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 11461 10976 gene locus_tag LOCUS_43660 11461 10976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 12360 12133 gene locus_tag LOCUS_43670 12360 12133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 13291 12509 gene locus_tag LOCUS_43680 13291 12509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 >Feature sequence060 859 2448 gene locus_tag LOCUS_43690 859 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 2706 2527 gene locus_tag LOCUS_43700 2706 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 4448 2880 gene locus_tag LOCUS_43710 gene hutH 4448 2880 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016650.1 protein_id gnl|my_center|LOCUS_43710 5754 4471 gene locus_tag LOCUS_43720 5754 4471 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 protein_id gnl|my_center|LOCUS_43720 7171 5768 gene locus_tag LOCUS_43730 7171 5768 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889640.1 protein_id gnl|my_center|LOCUS_43730 8343 7168 gene locus_tag LOCUS_43740 8343 7168 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861703.1 protein_id gnl|my_center|LOCUS_43740 8524 9870 gene locus_tag LOCUS_43750 8524 9870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 9949 10191 gene locus_tag LOCUS_43760 9949 10191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 10375 13254 gene locus_tag LOCUS_43770 10375 13254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 >Feature sequence061 638 75 gene locus_tag LOCUS_43780 638 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 1224 766 gene locus_tag LOCUS_43790 1224 766 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390210.1 protein_id gnl|my_center|LOCUS_43790 2002 1247 gene locus_tag LOCUS_43800 2002 1247 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902202.1 protein_id gnl|my_center|LOCUS_43800 2085 2726 gene locus_tag LOCUS_43810 2085 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 2880 2719 gene locus_tag LOCUS_43820 2880 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 2879 4153 gene locus_tag LOCUS_43830 2879 4153 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016767.1 protein_id gnl|my_center|LOCUS_43830 4167 4313 gene locus_tag LOCUS_43840 4167 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 4327 5460 gene locus_tag LOCUS_43850 4327 5460 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779464.1 protein_id gnl|my_center|LOCUS_43850 6040 5537 gene locus_tag LOCUS_43860 6040 5537 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082774.1 protein_id gnl|my_center|LOCUS_43860 6307 6858 gene locus_tag LOCUS_43870 6307 6858 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764887.1 protein_id gnl|my_center|LOCUS_43870 7325 6936 gene locus_tag LOCUS_43880 7325 6936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880 7798 7412 gene locus_tag LOCUS_43890 7798 7412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 7969 8319 gene locus_tag LOCUS_43900 7969 8319 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420359.1 protein_id gnl|my_center|LOCUS_43900 9354 8380 gene locus_tag LOCUS_43910 9354 8380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 10433 9369 gene locus_tag LOCUS_43920 10433 9369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 12285 10459 gene locus_tag LOCUS_43930 12285 10459 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700554.1 protein_id gnl|my_center|LOCUS_43930 13175 12297 gene locus_tag LOCUS_43940 13175 12297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 >Feature sequence062 <1 831 gene locus_tag LOCUS_43950 <1 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_211477941.1:SpaA isopeptide-forming pilin-related protein 920 1258 gene locus_tag LOCUS_43960 920 1258 CDS product DUF3852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158208705.1 protein_id gnl|my_center|LOCUS_43960 1267 1800 gene locus_tag LOCUS_43970 1267 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 1859 2725 gene locus_tag LOCUS_43980 1859 2725 CDS product DUF6045 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272168.1 protein_id gnl|my_center|LOCUS_43980 2736 2999 gene locus_tag LOCUS_43990 2736 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43990 2960 3169 gene locus_tag LOCUS_44000 2960 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44000 3300 4478 gene locus_tag LOCUS_44010 3300 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 5282 5016 gene locus_tag LOCUS_44020 5282 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 5435 6448 gene locus_tag LOCUS_44030 5435 6448 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970282.1 protein_id gnl|my_center|LOCUS_44030 7239 6568 gene locus_tag LOCUS_44040 7239 6568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 8503 7217 gene locus_tag LOCUS_44050 8503 7217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 8740 9072 gene locus_tag LOCUS_44060 8740 9072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 9296 10240 gene locus_tag LOCUS_44070 9296 10240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 11556 11389 gene locus_tag LOCUS_44080 11556 11389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 12188 11715 gene locus_tag LOCUS_44090 12188 11715 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894086.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44090 12900 12301 gene locus_tag LOCUS_44100 12900 12301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 >Feature sequence063 456 722 gene locus_tag LOCUS_44110 456 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 2430 622 gene locus_tag LOCUS_44120 2430 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 4746 2644 gene locus_tag LOCUS_44130 4746 2644 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861108.1 protein_id gnl|my_center|LOCUS_44130 4944 4747 gene locus_tag LOCUS_44140 4944 4747 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861109.1 protein_id gnl|my_center|LOCUS_44140 5660 4941 gene locus_tag LOCUS_44150 5660 4941 CDS product DUF4366 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035394374.1 protein_id gnl|my_center|LOCUS_44150 5919 5650 gene locus_tag LOCUS_44160 5919 5650 CDS product DUF4315 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861111.1 protein_id gnl|my_center|LOCUS_44160 6347 5952 gene locus_tag LOCUS_44170 6347 5952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 7930 6836 gene locus_tag LOCUS_44180 7930 6836 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202293.1 protein_id gnl|my_center|LOCUS_44180 8406 7927 gene locus_tag LOCUS_44190 8406 7927 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_44190 9760 9011 gene locus_tag LOCUS_44200 9760 9011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 11402 9774 gene locus_tag LOCUS_44210 11402 9774 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272556.1 protein_id gnl|my_center|LOCUS_44210 >Feature sequence064 349 1155 gene locus_tag LOCUS_44220 349 1155 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_44220 1158 2027 gene locus_tag LOCUS_44230 gene pstC 1158 2027 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073954.1 protein_id gnl|my_center|LOCUS_44230 2030 2887 gene locus_tag LOCUS_44240 gene pstA 2030 2887 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432350.1 protein_id gnl|my_center|LOCUS_44240 2884 3639 gene locus_tag LOCUS_44250 gene pstB 2884 3639 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986851.1 protein_id gnl|my_center|LOCUS_44250 3640 4296 gene locus_tag LOCUS_44260 gene phoU 3640 4296 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_44260 4293 4967 gene locus_tag LOCUS_44270 4293 4967 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_44270 4964 6643 gene locus_tag LOCUS_44280 4964 6643 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_44280 6956 6762 gene locus_tag LOCUS_44290 6956 6762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 8634 6895 gene locus_tag LOCUS_44300 8634 6895 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010247013.1 protein_id gnl|my_center|LOCUS_44300 10631 9198 gene locus_tag LOCUS_44310 10631 9198 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_44310 11758 10589 gene locus_tag LOCUS_44320 11758 10589 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_44320 >Feature sequence065 307 101 gene locus_tag LOCUS_44330 307 101 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870276.1 protein_id gnl|my_center|LOCUS_44330 755 618 gene locus_tag LOCUS_44340 755 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 2726 1329 gene locus_tag LOCUS_44350 2726 1329 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022042.1 protein_id gnl|my_center|LOCUS_44350 3605 4312 gene locus_tag LOCUS_44360 gene vanR 3605 4312 CDS product vancomycin resistance response regulator transcription factor VanR-I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461303.1 protein_id gnl|my_center|LOCUS_44360 4413 5444 gene locus_tag LOCUS_44370 4413 5444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 5574 6134 gene locus_tag LOCUS_44380 5574 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 6491 6727 gene locus_tag LOCUS_44390 6491 6727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 7405 7094 gene locus_tag LOCUS_44400 7405 7094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 7775 7542 gene locus_tag LOCUS_44410 7775 7542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 8102 8344 gene locus_tag LOCUS_44420 8102 8344 CDS product DUF3781 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438776.1 protein_id gnl|my_center|LOCUS_44420 8995 9552 gene locus_tag LOCUS_44430 8995 9552 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151110.1 protein_id gnl|my_center|LOCUS_44430 9969 9829 gene locus_tag LOCUS_44440 9969 9829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 11785 10064 gene locus_tag LOCUS_44450 11785 10064 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 protein_id gnl|my_center|LOCUS_44450 >Feature sequence066 75 1 gene locus_tag LOCUS_t00590 75 1 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1431 280 gene locus_tag LOCUS_44460 1431 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 1756 1577 gene locus_tag LOCUS_44470 1756 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 3195 1918 gene locus_tag LOCUS_44480 3195 1918 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731178.1 protein_id gnl|my_center|LOCUS_44480 3583 3356 gene locus_tag LOCUS_44490 3583 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 4613 3885 gene locus_tag LOCUS_44500 4613 3885 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028208.1 protein_id gnl|my_center|LOCUS_44500 5260 4613 gene locus_tag LOCUS_44510 5260 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 6156 5257 gene locus_tag LOCUS_44520 6156 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 7738 6338 gene locus_tag LOCUS_44530 7738 6338 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224493.1 protein_id gnl|my_center|LOCUS_44530 7943 8878 gene locus_tag LOCUS_44540 7943 8878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 9217 9948 gene locus_tag LOCUS_44550 9217 9948 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_44550 10184 10339 gene locus_tag LOCUS_44560 10184 10339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 10532 11527 gene locus_tag LOCUS_44570 10532 11527 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549977.1 protein_id gnl|my_center|LOCUS_44570 >Feature sequence067 126 479 gene locus_tag LOCUS_44580 126 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 575 874 gene locus_tag LOCUS_44590 575 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272182.1 protein_id gnl|my_center|LOCUS_44590 871 1842 gene locus_tag LOCUS_44600 871 1842 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462025.1 protein_id gnl|my_center|LOCUS_44600 1863 2369 gene locus_tag LOCUS_44610 1863 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 2359 3027 gene locus_tag LOCUS_44620 2359 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 3024 3404 gene locus_tag LOCUS_44630 3024 3404 CDS product SpoVG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272703.1 protein_id gnl|my_center|LOCUS_44630 3420 5153 gene locus_tag LOCUS_44640 3420 5153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 5281 6081 gene locus_tag LOCUS_44650 5281 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 6159 6536 gene locus_tag LOCUS_44660 6159 6536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 6428 10705 gene locus_tag LOCUS_44670 6428 10705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44670 10626 11507 gene locus_tag LOCUS_44680 10626 11507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44680 >Feature sequence068 1086 619 gene locus_tag LOCUS_44690 gene ribE 1086 619 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099502.1 protein_id gnl|my_center|LOCUS_44690 2307 1105 gene locus_tag LOCUS_44700 2307 1105 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885819.1 protein_id gnl|my_center|LOCUS_44700 2970 2323 gene locus_tag LOCUS_44710 2970 2323 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130990.1 protein_id gnl|my_center|LOCUS_44710 4054 2951 gene locus_tag LOCUS_44720 gene ribD 4054 2951 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284101.1 protein_id gnl|my_center|LOCUS_44720 4519 5061 gene locus_tag LOCUS_44730 4519 5061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 6937 5507 gene locus_tag LOCUS_44740 6937 5507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 7501 7247 gene locus_tag LOCUS_44750 7501 7247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 9167 7584 gene locus_tag LOCUS_44760 9167 7584 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048176.1 protein_id gnl|my_center|LOCUS_44760 10491 9196 gene locus_tag LOCUS_44770 10491 9196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 10844 10566 gene locus_tag LOCUS_44780 10844 10566 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613391.1 protein_id gnl|my_center|LOCUS_44780 11106 10837 gene locus_tag LOCUS_44790 11106 10837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 >Feature sequence069 1211 924 gene locus_tag LOCUS_44800 1211 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 1252 1401 gene locus_tag LOCUS_44810 1252 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44810 2139 1720 gene locus_tag LOCUS_44820 2139 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 3866 2571 gene locus_tag LOCUS_44830 3866 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44830 4456 3884 gene locus_tag LOCUS_44840 4456 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44840 5044 4484 gene locus_tag LOCUS_44850 5044 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 5426 5076 gene locus_tag LOCUS_44860 5426 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 5723 5436 gene locus_tag LOCUS_44870 5723 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 7156 5741 gene locus_tag LOCUS_44880 7156 5741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 7367 8041 gene locus_tag LOCUS_44890 7367 8041 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083233.1 protein_id gnl|my_center|LOCUS_44890 8276 8623 gene locus_tag LOCUS_44900 8276 8623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 8604 9179 gene locus_tag LOCUS_44910 8604 9179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 9632 10033 gene locus_tag LOCUS_44920 9632 10033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 10138 10590 gene locus_tag LOCUS_44930 10138 10590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 >Feature sequence070 <1 6252 gene locus_tag LOCUS_44940 <1 6252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164691239.1:SpaA isopeptide-forming pilin-related protein 6341 6673 gene locus_tag LOCUS_44950 6341 6673 CDS product DUF3852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158208705.1 protein_id gnl|my_center|LOCUS_44950 6722 7051 gene locus_tag LOCUS_44960 6722 7051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 7091 7960 gene locus_tag LOCUS_44970 7091 7960 CDS product DUF6045 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272168.1 protein_id gnl|my_center|LOCUS_44970 7977 8747 gene locus_tag LOCUS_44980 7977 8747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44980 8704 10083 gene locus_tag LOCUS_44990 8704 10083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 >Feature sequence071 122 322 gene locus_tag LOCUS_45000 122 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 326 535 gene locus_tag LOCUS_45010 326 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45010 551 1141 gene locus_tag LOCUS_45020 551 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 1138 1809 gene locus_tag LOCUS_45030 1138 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 1907 2404 gene locus_tag LOCUS_45040 1907 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 2415 3644 gene locus_tag LOCUS_45050 2415 3644 CDS product DUF2800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144597911.1 protein_id gnl|my_center|LOCUS_45050 3641 4027 gene locus_tag LOCUS_45060 3641 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 4042 4752 gene locus_tag LOCUS_45070 4042 4752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 4765 6753 gene locus_tag LOCUS_45080 4765 6753 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399687.1 protein_id gnl|my_center|LOCUS_45080 6758 7522 gene locus_tag LOCUS_45090 6758 7522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 7526 7678 gene locus_tag LOCUS_45100 7526 7678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 7864 8880 gene locus_tag LOCUS_45110 7864 8880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45110 8889 9248 gene locus_tag LOCUS_45120 8889 9248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 >Feature sequence072 239 54 gene locus_tag LOCUS_45130 239 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 367 215 gene locus_tag LOCUS_45140 367 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45140 1684 395 gene locus_tag LOCUS_45150 1684 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 2403 1681 gene locus_tag LOCUS_45160 2403 1681 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948727.1 protein_id gnl|my_center|LOCUS_45160 2584 2381 gene locus_tag LOCUS_45170 2584 2381 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434206.1 protein_id gnl|my_center|LOCUS_45170 2910 3083 gene locus_tag LOCUS_45180 2910 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 3208 3540 gene locus_tag LOCUS_45190 3208 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 3551 4027 gene locus_tag LOCUS_45200 3551 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 4112 4357 gene locus_tag LOCUS_45210 4112 4357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45210 4477 5148 gene locus_tag LOCUS_45220 4477 5148 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986505.1 protein_id gnl|my_center|LOCUS_45220 5222 6550 gene locus_tag LOCUS_45230 5222 6550 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986504.1 protein_id gnl|my_center|LOCUS_45230 6811 7563 gene locus_tag LOCUS_45240 6811 7563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 8154 7966 gene locus_tag LOCUS_45250 8154 7966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 8599 8141 gene locus_tag LOCUS_45260 8599 8141 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003061815.1 protein_id gnl|my_center|LOCUS_45260 >Feature sequence073 104 625 gene locus_tag LOCUS_45270 104 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 5465 666 gene locus_tag LOCUS_45280 5465 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45280 5620 5480 gene locus_tag LOCUS_45290 5620 5480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45290 6175 6705 gene locus_tag LOCUS_45300 6175 6705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 >Feature sequence074 999 421 gene locus_tag LOCUS_45310 999 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 4744 1142 gene locus_tag LOCUS_45320 gene addA 4744 1142 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572274.1 protein_id gnl|my_center|LOCUS_45320 6286 4802 gene locus_tag LOCUS_45330 gene gltX 6286 4802 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_45330 6452 8149 gene locus_tag LOCUS_45340 6452 8149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807777.1 protein_id gnl|my_center|LOCUS_45340 >Feature sequence075 166 336 gene locus_tag LOCUS_45350 166 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45350 357 545 gene locus_tag LOCUS_45360 357 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 542 1090 gene locus_tag LOCUS_45370 542 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310171.1 protein_id gnl|my_center|LOCUS_45370 1096 1311 gene locus_tag LOCUS_45380 1096 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 1308 1616 gene locus_tag LOCUS_45390 1308 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 1641 4037 gene locus_tag LOCUS_45400 1641 4037 CDS product VapE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714181.1 protein_id gnl|my_center|LOCUS_45400 4300 4587 gene locus_tag LOCUS_45410 4300 4587 CDS product VRR-NUC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714182.1 protein_id gnl|my_center|LOCUS_45410 4584 5969 gene locus_tag LOCUS_45420 4584 5969 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113850176.1 protein_id gnl|my_center|LOCUS_45420 5966 6349 gene locus_tag LOCUS_45430 5966 6349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 6346 6741 gene locus_tag LOCUS_45440 6346 6741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45440 >Feature sequence076 1406 747 gene locus_tag LOCUS_45450 1406 747 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811515.1 protein_id gnl|my_center|LOCUS_45450 1538 2089 gene locus_tag LOCUS_45460 1538 2089 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964041.1 protein_id gnl|my_center|LOCUS_45460 2187 2543 gene locus_tag LOCUS_45470 2187 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 4225 2732 gene locus_tag LOCUS_45480 4225 2732 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368703.1 protein_id gnl|my_center|LOCUS_45480 4577 4227 gene locus_tag LOCUS_45490 gene mobC 4577 4227 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426139.1 protein_id gnl|my_center|LOCUS_45490 5121 4579 gene locus_tag LOCUS_45500 5121 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 5599 5246 gene locus_tag LOCUS_45510 5599 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45510 5777 5604 gene locus_tag LOCUS_45520 5777 5604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 6448 5774 gene locus_tag LOCUS_45530 6448 5774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 6702 6445 gene locus_tag LOCUS_45540 6702 6445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45540 <7340 6806 gene locus_tag LOCUS_45550 <7340 6806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103677717.1:MT-A70 family methyltransferase >Feature sequence077 372 1337 gene locus_tag LOCUS_45560 372 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45560 1327 1749 gene locus_tag LOCUS_45570 1327 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 1749 2159 gene locus_tag LOCUS_45580 1749 2159 CDS product DUF2634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861039.1 protein_id gnl|my_center|LOCUS_45580 2160 3377 gene locus_tag LOCUS_45590 2160 3377 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861040.1 protein_id gnl|my_center|LOCUS_45590 3370 3999 gene locus_tag LOCUS_45600 3370 3999 CDS product YmfQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861041.1 protein_id gnl|my_center|LOCUS_45600 4002 4739 gene locus_tag LOCUS_45610 4002 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 4742 5293 gene locus_tag LOCUS_45620 4742 5293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 5671 6696 gene locus_tag LOCUS_45630 5671 6696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45630 >Feature sequence078 70 1569 gene locus_tag LOCUS_45640 70 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 1640 2233 gene locus_tag LOCUS_45650 1640 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45650 2945 2433 gene locus_tag LOCUS_45660 2945 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 5515 3938 gene locus_tag LOCUS_45670 5515 3938 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_45670 5695 5555 gene locus_tag LOCUS_45680 5695 5555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 6720 5911 gene locus_tag LOCUS_45690 6720 5911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 6864 6940 gene locus_tag LOCUS_t00600 6864 6940 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence079 166 1125 gene locus_tag LOCUS_45700 166 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 2666 1596 gene locus_tag LOCUS_45710 2666 1596 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836297.1 protein_id gnl|my_center|LOCUS_45710 4028 2754 gene locus_tag LOCUS_45720 4028 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 4703 4338 gene locus_tag LOCUS_45730 4703 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272167.1 protein_id gnl|my_center|LOCUS_45730 5596 4727 gene locus_tag LOCUS_45740 5596 4727 CDS product DUF6045 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272168.1 protein_id gnl|my_center|LOCUS_45740 5992 5636 gene locus_tag LOCUS_45750 5992 5636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45750 6341 6009 gene locus_tag LOCUS_45760 6341 6009 CDS product DUF3852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158208705.1 protein_id gnl|my_center|LOCUS_45760 >Feature sequence080 1336 506 gene locus_tag LOCUS_45770 1336 506 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896899.1 protein_id gnl|my_center|LOCUS_45770 1729 2085 gene locus_tag LOCUS_45780 1729 2085 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324548.1 protein_id gnl|my_center|LOCUS_45780 3701 2274 gene locus_tag LOCUS_45790 3701 2274 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368703.1 protein_id gnl|my_center|LOCUS_45790 4071 3781 gene locus_tag LOCUS_45800 4071 3781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45800 4578 4228 gene locus_tag LOCUS_45810 gene mobC 4578 4228 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426139.1 protein_id gnl|my_center|LOCUS_45810 5176 4580 gene locus_tag LOCUS_45820 5176 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45820 5660 5310 gene locus_tag LOCUS_45830 5660 5310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45830 6509 5835 gene locus_tag LOCUS_45840 6509 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 >Feature sequence081 1803 1201 gene locus_tag LOCUS_45850 1803 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 2238 1807 gene locus_tag LOCUS_45860 2238 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 2396 3442 gene locus_tag LOCUS_45870 2396 3442 CDS product IS30-like element ISTde2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956682.1 protein_id gnl|my_center|LOCUS_45870 4197 3598 gene locus_tag LOCUS_45880 4197 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_45880 5983 4532 gene locus_tag LOCUS_45890 5983 4532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45890 6429 5980 gene locus_tag LOCUS_45900 6429 5980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 >Feature sequence082 200 78 gene locus_tag LOCUS_45910 200 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 1589 219 gene locus_tag LOCUS_45920 1589 219 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272456.1 protein_id gnl|my_center|LOCUS_45920 2281 1586 gene locus_tag LOCUS_45930 2281 1586 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012994104.1 protein_id gnl|my_center|LOCUS_45930 2428 3351 gene locus_tag LOCUS_45940 2428 3351 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861095.1 protein_id gnl|my_center|LOCUS_45940 3344 4132 gene locus_tag LOCUS_45950 3344 4132 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861094.1 protein_id gnl|my_center|LOCUS_45950 4134 4931 gene locus_tag LOCUS_45960 4134 4931 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861093.1 protein_id gnl|my_center|LOCUS_45960 4928 5308 gene locus_tag LOCUS_45970 4928 5308 CDS product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003588552.1 protein_id gnl|my_center|LOCUS_45970 <6289 5704 gene locus_tag LOCUS_45980 <6289 5704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000449124.1:DUF4240 domain-containing protein >Feature sequence083 777 595 gene locus_tag LOCUS_45990 777 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 1542 1318 gene locus_tag LOCUS_46000 1542 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 1972 1514 gene locus_tag LOCUS_46010 1972 1514 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989664.1 protein_id gnl|my_center|LOCUS_46010 3438 2044 gene locus_tag LOCUS_46020 3438 2044 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 protein_id gnl|my_center|LOCUS_46020 4201 3656 gene locus_tag LOCUS_46030 4201 3656 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966606.1 protein_id gnl|my_center|LOCUS_46030 4347 4679 gene locus_tag LOCUS_46040 4347 4679 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420359.1 protein_id gnl|my_center|LOCUS_46040 5337 4747 gene locus_tag LOCUS_46050 5337 4747 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948663.1 protein_id gnl|my_center|LOCUS_46050 5865 5428 gene locus_tag LOCUS_46060 5865 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46060 >Feature sequence084 257 1786 gene locus_tag LOCUS_r00010 257 1786 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1910 1986 gene locus_tag LOCUS_t00610 1910 1986 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 2002 2077 gene locus_tag LOCUS_t00620 2002 2077 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2322 5160 gene locus_tag LOCUS_r00020 2322 5160 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5370 5445 gene locus_tag LOCUS_t00630 5370 5445 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5448 5522 gene locus_tag LOCUS_t00640 5448 5522 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence085 213 719 gene locus_tag LOCUS_46070 213 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46070 907 2907 gene locus_tag LOCUS_46080 907 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 4017 3136 gene locus_tag LOCUS_46090 4017 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_46090 4558 4037 gene locus_tag LOCUS_46100 4558 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 5613 4516 gene locus_tag LOCUS_46110 5613 4516 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_46110 >Feature sequence086 1040 261 gene locus_tag LOCUS_46120 1040 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46120 2026 1169 gene locus_tag LOCUS_46130 2026 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 2989 2060 gene locus_tag LOCUS_46140 2989 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 3474 3004 gene locus_tag LOCUS_46150 3474 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 4270 3512 gene locus_tag LOCUS_46160 4270 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46160 4766 4260 gene locus_tag LOCUS_46170 4766 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46170 <5526 4789 gene locus_tag LOCUS_46180 <5526 4789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458865.1:DNA adenine methylase >Feature sequence087 2604 2906 gene locus_tag LOCUS_46190 2604 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46190 3015 3914 gene locus_tag LOCUS_46200 3015 3914 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391904.1 protein_id gnl|my_center|LOCUS_46200 3907 4098 gene locus_tag LOCUS_46210 3907 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 4202 5338 gene locus_tag LOCUS_46220 4202 5338 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272155.1 protein_id gnl|my_center|LOCUS_46220 >Feature sequence088 2069 2908 gene locus_tag LOCUS_46230 2069 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 2960 3688 gene locus_tag LOCUS_46240 2960 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46240 3685 3882 gene locus_tag LOCUS_46250 3685 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 >Feature sequence089 188 1618 gene locus_tag LOCUS_46260 188 1618 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_46260 1767 2645 gene locus_tag LOCUS_46270 1767 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46270 3240 3043 gene locus_tag LOCUS_46280 3240 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 3199 3909 gene locus_tag LOCUS_46290 3199 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_46290 >Feature sequence090 2562 445 gene locus_tag LOCUS_46300 2562 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 4376 2583 gene locus_tag LOCUS_46310 4376 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46310 4561 4400 gene locus_tag LOCUS_46320 4561 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 >Feature sequence091 <1 918 gene locus_tag LOCUS_46330 <1 918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_163066848.1:recombinase family protein 2460 1300 gene locus_tag LOCUS_46340 2460 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46340 2700 2921 gene locus_tag LOCUS_46350 2700 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46350 3354 2908 gene locus_tag LOCUS_46360 3354 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46360 <3886 3278 gene locus_tag LOCUS_46370 <3886 3278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109552.1:SpaA isopeptide-forming pilin-related protein >Feature sequence092 <1 1264 gene locus_tag LOCUS_46380 <1 1264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942590.1:Ig-like domain-containing protein 1261 1719 gene locus_tag LOCUS_46390 1261 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 1733 2065 gene locus_tag LOCUS_46400 1733 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 2081 2359 gene locus_tag LOCUS_46410 2081 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46410 2376 3386 gene locus_tag LOCUS_46420 2376 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46420 >Feature sequence093 638 156 gene locus_tag LOCUS_46430 638 156 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368727.1 protein_id gnl|my_center|LOCUS_46430 1402 701 gene locus_tag LOCUS_46440 1402 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46440 1745 1404 gene locus_tag LOCUS_46450 1745 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 3567 2065 gene locus_tag LOCUS_46460 3567 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46460 >Feature sequence094 968 90 gene locus_tag LOCUS_46470 968 90 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003321939.1 protein_id gnl|my_center|LOCUS_46470 2088 1099 gene locus_tag LOCUS_46480 2088 1099 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970904.1 protein_id gnl|my_center|LOCUS_46480 3293 2085 gene locus_tag LOCUS_46490 3293 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46490 >Feature sequence095 <1 716 gene locus_tag LOCUS_46500 <1 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047637.1:phage portal protein 700 2445 gene locus_tag LOCUS_46510 700 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 2445 2696 gene locus_tag LOCUS_46520 2445 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 2721 2843 gene locus_tag LOCUS_46530 2721 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46530 >Feature sequence096 213 689 gene locus_tag LOCUS_46540 213 689 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429851.1 protein_id gnl|my_center|LOCUS_46540 722 1150 gene locus_tag LOCUS_46550 722 1150 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429853.1 protein_id gnl|my_center|LOCUS_46550 1153 1344 gene locus_tag LOCUS_46560 1153 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 1349 1519 gene locus_tag LOCUS_46570 1349 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46570 1652 1467 gene locus_tag LOCUS_46580 1652 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 1796 2143 gene locus_tag LOCUS_46590 1796 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 >Feature sequence097 909 115 gene locus_tag LOCUS_46600 909 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 1672 899 gene locus_tag LOCUS_46610 1672 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46610 2592 1726 gene locus_tag LOCUS_46620 2592 1726 CDS product CD0415/CD1112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368724.1 protein_id gnl|my_center|LOCUS_46620 >Feature sequence098 817 365 gene locus_tag LOCUS_46630 817 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 1173 847 gene locus_tag LOCUS_46640 1173 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 1541 1188 gene locus_tag LOCUS_46650 1541 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 2599 1544 gene locus_tag LOCUS_46660 2599 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 >Feature sequence099 388 1710 gene locus_tag LOCUS_46670 388 1710 CDS product IS5-like element ISLca2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568911.1 protein_id gnl|my_center|LOCUS_46670 1830 2591 gene locus_tag LOCUS_46680 1830 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 >Feature sequence100 830 1324 gene locus_tag LOCUS_46690 830 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46690 1357 2265 gene locus_tag LOCUS_46700 1357 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46700 >Feature sequence101 83 631 gene locus_tag LOCUS_46710 83 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 618 1226 gene locus_tag LOCUS_46720 618 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46720 1304 1744 gene locus_tag LOCUS_46730 1304 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46730 1741 2214 gene locus_tag LOCUS_46740 1741 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 >Feature sequence102 540 328 gene locus_tag LOCUS_46750 540 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46750 >Feature sequence103 1194 697 gene locus_tag LOCUS_46760 1194 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46760 1468 1274 gene locus_tag LOCUS_46770 1468 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46770 1899 1471 gene locus_tag LOCUS_46780 1899 1471 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429853.1 protein_id gnl|my_center|LOCUS_46780 >Feature sequence104 853 227 gene locus_tag LOCUS_46790 853 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46790 >Feature sequence105 747 499 gene locus_tag LOCUS_46800 747 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46800 <1917 752 gene locus_tag LOCUS_46810 <1917 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003429838.1:minor capsid protein >Feature sequence106 318 1133 gene locus_tag LOCUS_46820 318 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46820 1111 1812 gene locus_tag LOCUS_46830 1111 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46830 >Feature sequence107 70 978 gene locus_tag LOCUS_46840 70 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46840 1172 1786 gene locus_tag LOCUS_46850 1172 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 >Feature sequence108 24 449 gene locus_tag LOCUS_46860 24 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 454 651 gene locus_tag LOCUS_46870 454 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46870 >Feature sequence109 753 49 gene locus_tag LOCUS_46880 753 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 1205 1447 gene locus_tag LOCUS_46890 1205 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_46890 >Feature sequence110 >Feature sequence111 75 1349 gene locus_tag LOCUS_46900 75 1349 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288357.1 protein_id gnl|my_center|LOCUS_46900 >Feature sequence112 739 341 gene locus_tag LOCUS_46910 739 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 >Feature sequence113 1482 253 gene locus_tag LOCUS_46920 1482 253 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_46920 >Feature sequence114 768 592 gene locus_tag LOCUS_46930 768 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 >Feature sequence115 >Feature sequence116 312 1481 gene locus_tag LOCUS_46940 312 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46940 >Feature sequence117 >Feature sequence118 >Feature sequence119 >Feature sequence120 >Feature sequence121 1120 119 gene locus_tag LOCUS_46950 1120 119 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064634869.1 protein_id gnl|my_center|LOCUS_46950 >Feature sequence122 611 114 gene locus_tag LOCUS_46960 611 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46960 1145 762 gene locus_tag LOCUS_46970 1145 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46970 >Feature sequence123 1035 631 gene locus_tag LOCUS_46980 1035 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46980 >Feature sequence124 >Feature sequence125 >Feature sequence126 1 249 gene locus_tag LOCUS_46990 1 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46990 261 716 gene locus_tag LOCUS_47000 261 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47000